<html><head></head><body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; ">You would need to do it by hand or write a script to help you, no such program is available from us at this time. However if you write one it would be great if you could share it with the world. With that in mind, do you mind subscribing to the rnatoolbox-help email list? Then we can keep track of these issues.<div><br></div><div>Sam</div><div><br></div><div><br><div><div>On Mar 4, 2010, at 2:31 PM, Raman Parkesh wrote:</div><br class="Apple-interchange-newline"><blockquote type="cite"><div>HI Sam<div>Thanks for your help yesterday. The sequence I have is</div><div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
GGGAGAGGGUUUAAUCUGUACGAAAGUACUGAUUGGAUCCGCAAGG</div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; "><br></div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
with constraint as</div><p style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; "></p><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
......((((((((((.((((....)))).))))))))))......</div><p style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; "> </p><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
I generated the secondary structure using Vienna RNA server and I saved the file format in .ct format. I was wondering is there any utility which helps you to convert .ct format to .dat format?</div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
<br></div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">or you have to manually modify the dat file. for example in my case I will have to specify the watson crick base pairing begining for 7th base with the 43th base and continue on. Is this correct?</div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; "><br></div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">
Regards</div><div style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0px; font: normal normal normal 11px/normal 'Lucida Grande'; ">Raman</div><div><br class="webkit-block-placeholder"></div></div><div class="gmail_quote">On 3 March 2010 21:00, Raman Parkesh <span dir="ltr"><<a href="mailto:rparkesh@gmail.com" target="_blank">rparkesh@gmail.com</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin-top: 0px; margin-right: 0px; margin-bottom: 0px; margin-left: 0.8ex; border-left-width: 1px; border-left-color: rgb(204, 204, 204); border-left-style: solid; padding-left: 1ex; position: static; z-index: auto; ">
HI <div>thanks my number is</div><div>regards</div><div>Raman<div><div></div><div><br><br><div class="gmail_quote">On 3 March 2010 20:58, Samuel Coulbourn Flores <span dir="ltr"><<a href="mailto:scflores@stanford.edu" target="_blank">scflores@stanford.edu</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex"><div style="word-wrap:break-word">call me again .. i hung up accidentally<div><br></div><div>also maybe you should give me your number</div>
<div><br></div><div>sam</div><div><br></div><div><div><div><div>On Mar 2, 2010, at 7:14 PM, Raman Parkesh wrote:</div><br></div><div><div></div><div><blockquote type="cite">Dear Prof.Coulbourn<div>I was trying your tutorial for RNABuilder. I am writing you to request for some information about how you can generate the following files from RNA secondary structures</div>
<div><br></div><div><span style="font-family:Verdana">Base-interactionparameters.</span></div><div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px"><span style="font-size:small">pseudoelectrostatic.csv and</span></div>
<div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px"><span style="font-size:small">contacts.singlebasepair.1.dat</span></div><div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px">
<span style="font-size:small"><br></span></div><div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px"><span style="font-size:small">Your help will be appreciated.</span></div><div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px">
<span style="font-size:small">Regards</span></div><div style="margin-top:0px;margin-right:0px;margin-bottom:0px;margin-left:0px"><span style="font-size:small">Raman</span></div>
</blockquote></div></div></div><br></div></div></blockquote></div><br></div></div></div>
</blockquote></div><br></div>
</blockquote></div><br></div></body></html>