Thanks for your kind instruction! I first tried to add MD command for the unpaired region: setDefaultMDParameters includeResidues A 1 4 includeResidues B 1 4 includeResidues C 27 44 The problem of miss bonds in the unpaired region was solved. Then I rigidified the unpaired region to run MD for the p...

Hi Sam, I've been modeling a complex composed of 3 ssDNA, here is the code I use: #sequence DNA A 1 AAAAGCTGTGACTCGT DNA B 1 AAAACCCCCAGGTTCTCT DNA C 1 ACGAGTCACAGCAGAGAACCTGGGGGAGTATTGCGGAGGAAGGT # stages firstStage 1 lastStage 1 #general simulation parameters # This is a multiplying factor for the...