You need to run this in a terminal or console window.

Really I am not a fan of Windows. I recommend installing ubuntu on a USB and then downloading MMB 2.17.1 for Linux. You will find instructions in the tutorial guide for running it.

Sam

Very well. here is the commands.dat you would use: firstStage 2 lastStage 2 # Initial -- "template" fragment loadSequencesFromPdb renumbered.txt # TP53 -- "target" fragment RNA B 1 UUAGGUACUAAGGUUCACCGGUGAACCUUAGUACCUAA # worry about steric clashes only in the loop. Elsewhere, the coordinates are ba...

Ciao Martina, Firstly, I would strongly encourage you to use MMB 17.2, the latest release. I see you are using Windows, which would explain why you went with an old release. Do you have access to a mac or linux machine? It could be that the "mobilizer Rigid" command is not working properly. Hard for...

Ack! Sorry I missed this. I was getting ready for my summer teaching, not that that is such a great excuse. Your first problem is that "Cis" should be capitalized. Sorry MMB is case-sensitive. I have not gotten around to making it case-insensitive. However the "Cis" thing alone is not enough. I actu...

Hi Peter, it's a bit hard for third parties like myself to follow this. There are more than 10 million Pis in the world now, so I feel that it's not a bad platform to support. Why not put the right switches in CMakeLists to handle the case of the Pi? We would be happy to give you access to our raspb...

Guys, I just upgraded to OS Sierra and am having some link issues. I was able to compile, using the flags : -std=c++14 -stdlib=libc++ , architecture x86_64 , deploying to OS 10.12 . The OpenMM tests pass. The problem is that when I link libOpenMM.dylib to my code, it tells me that the computeNeighbo...

Turns out it wanted me to set -stdlib=libc++ for some reason..

having some additional problems, but the above seems to be fixed now

thanks
sam

I did include it in my Utils.h: 21 #include <cstddef> 22 #include "SimTKsimbody.h" 23 #include "SimTKmolmodel.h" Based on your comment I also added it to ClonePtr.h , though I would think that would have come up before if that were the issue: 27 #include "SimTKcommon/internal/common.h" 28 29 #includ...

Guys, I am now further along. Now when compiling MMB I am getting a hard error in ClonePtr.h, appended below. It seems like something that should have come up when I compiled simbody or molmodel, but those all compiled just fine. Thanks in advance for any advice. Sam nl110-99-73:build Sam$ /usr/bin/...

Good to know that's not the problem. I'll continue hacking. Should I be using -std=c++14 , on simbody, openmm, and molmodel?