Hi,
Here is my command file in which I am trying to flexibilize the regions with problems (in chain A, 1 - 32 and 103 - 138). I have tried to fix all other regions of chain A and chain B
In last.1.pdb (before running the command file) I copied both chains A (model) and chain B (template). Both these structures are superposed to each other and based on the alignment generated from the superposition I have some insertions and deletion that I want in the model to be modeled correctly, for example the regions in model chain A (1 - 32 and 103 - 138) are not modeled well so I am trying to fix all remaining regions of chain A model and flexibilize these regions mentioned above.
# Put chian A and B in last.1.pdb
firstStage 1
lastStage 2
reportingInterval .5
numReportingIntervals 10
removeRigidBodyMomentum False
-- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
"threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
constrainToGround A 1
constrainToGround B 1
constraint A 1 Weld A 229
constraint B 1 Weld B 247
mobilizer Rigid A 33 102 #1-32 are to be modeled well, so flexible
mobilizer Rigid A 139 229 # 103-138 are to be modeled well, so flexible
leontisWesthofInFileName parameters.csv
temperature 10.0
But this does not serve the purpose and am not getting the desired output. The corresponding files are here :
last.1.pdb (after running command file):
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb
last.1.pdb (before running command file)
https://www.dropbox.com/s/9r8fkgdt7ab5a ... before-run
last.2.pdb :
https://www.dropbox.com/s/e2zqqq0ecrelzxu/last.2.pdb
trajectory.1.pdb :
https://www.dropbox.com/s/or883kiwwe7ox ... tory.1.pdb
trajectory.2.pdb :
https://www.dropbox.com/s/ncuwqbgsecww8 ... tory.2.pdb
template.pdb :
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb
model.pdb:
https://www.dropbox.com/s/lau7e8ls9kwnnnt/model.pdb
model-native-structure.pdb: (The structure already available for the model)
https://www.dropbox.com/s/acfunyqlrf3ev ... cuture.pdb
Please let me know where am i getting wrong and what parameters I need to add in the command file to serve the purpose to just focus on one insertion/deletion and work on fixing that problem.
Thank you.
cheers
parameters.csv file for RNA modeling
-
Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
-
Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
you should set firstStage 2.
Stage 1 is the only stage which takes no structure file. Thus it instantiates all chains using default (extended) internal coordinates. last.1.pdb is written at the end of stage 1. This is why your last.1.pdb is being overwritten. Please read about stages in the Tutorial Guide. There is a flowchart that explains this concept.
Your last.1.pdb (before overwriting) has some bond geometry problems. You might want to let MMB do the whole threading job, rather than trying to use it to repair bad geometries generated by another threading program.
Once again you have no "threading" command in your command file. Even if you were to fix the bond geometry issues, nothing would happen here. PLEASE do the threading example in the tutorial. You would also benefit from doing the simple hairpin example. Maybe the Transactivation Response Element (TAR) example as well.
Sam
Stage 1 is the only stage which takes no structure file. Thus it instantiates all chains using default (extended) internal coordinates. last.1.pdb is written at the end of stage 1. This is why your last.1.pdb is being overwritten. Please read about stages in the Tutorial Guide. There is a flowchart that explains this concept.
Your last.1.pdb (before overwriting) has some bond geometry problems. You might want to let MMB do the whole threading job, rather than trying to use it to repair bad geometries generated by another threading program.
Once again you have no "threading" command in your command file. Even if you were to fix the bond geometry issues, nothing would happen here. PLEASE do the threading example in the tutorial. You would also benefit from doing the simple hairpin example. Maybe the Transactivation Response Element (TAR) example as well.
Sam
-
Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Thank you for your suggestions again. I have already done the tutorial examples. I am trying different options to get better result. I have modified the command file as per suggestions. The process is running, but in this process complete chain A is threaded ( based on the threading forces mentioned below in the command file ) to rigidified chain B. This slows down the process.
Is there a way in MMB, in which I dont need to thread the chains. Start from the superposed structure, rigidify all the regions of chain A and B (already superposed) and flexibilize the problematic regions of model chain A ?
If you have some suggestions to give for the command file below to improve the run, please let me know.
In this run "last.1.pdb" contains the chain B (template)
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb
# Put chain B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B 1 247
#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
cheer!
Deepak
Is there a way in MMB, in which I dont need to thread the chains. Start from the superposed structure, rigidify all the regions of chain A and B (already superposed) and flexibilize the problematic regions of model chain A ?
If you have some suggestions to give for the command file below to improve the run, please let me know.
In this run "last.1.pdb" contains the chain B (template)
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb
# Put chain B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B 1 247
#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
cheer!
Deepak
-
Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
I think you're starting to get some traction on this.
There was only one bug in your command file, here:
mobilizer Rigid B 1 247
the first residue of chain B is residue 2, not 1. I don't know how you could run this and not get an error. The last residue of chain B is 248, not 247. That wouldn't kill execution, but is an indication your residue numbers might be wrong. You can also do :
mobilizer Rigid B
.. which rigidifies all of chain B.
It is in fact possible to also put chain A into last.1.pdb, which would mean starting with a folded chain A. The problem is that your chain A had some really bad bond geometries, and needed some manual tweaking before the internal coordinates of the molecule could be computed. I indicated in an earlier message, the first two positions where I found such problems. However I feel that perhaps it would be productive to see where the alignment goes, now that you have it running.
It might be productive to pop the baseInteraction commands back in to your command file, to neaten up the base pairing interactions. But like I say, let's see how the threading goes first.
Sam
Sam
There was only one bug in your command file, here:
mobilizer Rigid B 1 247
the first residue of chain B is residue 2, not 1. I don't know how you could run this and not get an error. The last residue of chain B is 248, not 247. That wouldn't kill execution, but is an indication your residue numbers might be wrong. You can also do :
mobilizer Rigid B
.. which rigidifies all of chain B.
It is in fact possible to also put chain A into last.1.pdb, which would mean starting with a folded chain A. The problem is that your chain A had some really bad bond geometries, and needed some manual tweaking before the internal coordinates of the molecule could be computed. I indicated in an earlier message, the first two positions where I found such problems. However I feel that perhaps it would be productive to see where the alignment goes, now that you have it running.
It might be productive to pop the baseInteraction commands back in to your command file, to neaten up the base pairing interactions. But like I say, let's see how the threading goes first.
Sam
Sam
-
Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Thanks again.
I will let you know when the process is finished. Meanwhile could you please help me in some more queries related to MMB:
a) I tried running the process with already folded and superposed chain B and chain A but it gives error and when I remove chain A the program runs. This means that the program cannot execute chain A. As you pointed that due to bad bond geometries of the model this could be possible. Does minimizing the model could solve this problem and MMB accept the minimized model ? instead of repairing the bonds manually.
b) To perform:
restraints on the secondary structures and long range interactions
what MMb functions would serve this purpose best?
c) Once the model is prepared with better RMSD . Can optimization of the model be done using MMB?
1)Optimization of variable parts (and frozen core)
2) Free model optmization
Thanks.
cheers!
I will let you know when the process is finished. Meanwhile could you please help me in some more queries related to MMB:
a) I tried running the process with already folded and superposed chain B and chain A but it gives error and when I remove chain A the program runs. This means that the program cannot execute chain A. As you pointed that due to bad bond geometries of the model this could be possible. Does minimizing the model could solve this problem and MMB accept the minimized model ? instead of repairing the bonds manually.
b) To perform:
restraints on the secondary structures and long range interactions
what MMb functions would serve this purpose best?
c) Once the model is prepared with better RMSD . Can optimization of the model be done using MMB?
1)Optimization of variable parts (and frozen core)
2) Free model optmization
Thanks.
cheers!
-
Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
yes, you can minimize chain A and use the minimized result as an input to MMB. Hopefully that would take care of the bad bond geometries. However you would need to do this minimization in another package.
Since it's just a few places where you have these problems, I would just cut pieces from the 3' end of chain A, in your command file, until you identify the problem residue. Then adjust atom positions slightly in the PDB file using a text editor. There will probably be several, so fix them one at a time starting from the 5' end.
Back to your current threading .. a problem with the threading command is that it is based on atom names. The means where you mutate purine to pyrimidine or vice versa, the glycosidic bond angle will not be matched. You might try, in addition to the "threading" command, base interactions like this:
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
... etc
This will align the base of A 32 onto that of B 3, independently of residue type.
Sam
Since it's just a few places where you have these problems, I would just cut pieces from the 3' end of chain A, in your command file, until you identify the problem residue. Then adjust atom positions slightly in the PDB file using a text editor. There will probably be several, so fix them one at a time starting from the 5' end.
Back to your current threading .. a problem with the threading command is that it is based on atom names. The means where you mutate purine to pyrimidine or vice versa, the glycosidic bond angle will not be matched. You might try, in addition to the "threading" command, base interactions like this:
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
... etc
This will align the base of A 32 onto that of B 3, independently of residue type.
Sam
-
Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Thanks.
I am putting the results of 1st run based on this command file below:
Please let me know about your comments on this result
# Put chian-B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B
#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
last.1.pdb :
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb
trajectory.2.pdb:
https://www.dropbox.com/s/ncuwqbgsecww8 ... tory.2.pdb
last.2.pdb:
https://www.dropbox.com/s/e2zqqq0ecrelzxu/last.2.pdb
model-native.pdb
https://www.dropbox.com/s/t1sbi1rx3qfm0 ... native.pdb
template.pdb:
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb
model-before-MMB-run
https://www.dropbox.com/s/23snpa4fqcaji ... MB-run.pdb
In the trajectory.2.pdb and last.2.pdb we see that the model did try to take a conformation but the result is not satisfactory.
Apart from threaded regions, the insertions/deletion regions that were well modeled were affected by MMB run, so in this next run (command file below) I am trying to rigidify all the regions of model chain A except for the regions I want to model well.
Please let me know if you think this command file could be improved to serve the purpose.
New command file:
# Put chain B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
mobilizer Rigid A 33 102 # want only region 1-32 to be remodeled
mobilizer Rigid A 139 229 # want only region 103-138 to be remodeled
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 139 Superimpose B 176 Superimpose Cis
baseInteraction A 140 Superimpose B 177 Superimpose Cis
baseInteraction A 141 Superimpose B 178 Superimpose Cis
baseInteraction A 142 Superimpose B 179 Superimpose Cis
baseInteraction A 143 Superimpose B 180 Superimpose Cis
baseInteraction A 144 Superimpose B 181 Superimpose Cis
baseInteraction A 145 Superimpose B 182 Superimpose Cis
baseInteraction A 146 Superimpose B 183 Superimpose Cis
baseInteraction A 147 Superimpose B 184 Superimpose Cis
baseInteraction A 148 Superimpose B 185 Superimpose Cis
baseInteraction A 149 Superimpose B 186 Superimpose Cis
baseInteraction A 150 Superimpose B 187 Superimpose Cis
baseInteraction A 151 Superimpose B 188 Superimpose Cis
baseInteraction A 152 Superimpose B 189 Superimpose Cis
baseInteraction A 153 Superimpose B 190 Superimpose Cis
baseInteraction A 154 Superimpose B 191 Superimpose Cis
baseInteraction A 155 Superimpose B 192 Superimpose Cis
baseInteraction A 156 Superimpose B 193 Superimpose Cis
baseInteraction A 157 Superimpose B 194 Superimpose Cis
baseInteraction A 158 Superimpose B 195 Superimpose Cis
baseInteraction A 159 Superimpose B 196 Superimpose Cis
baseInteraction A 160 Superimpose B 197 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
Thanks
cheers!
I am putting the results of 1st run based on this command file below:
Please let me know about your comments on this result
# Put chian-B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B
#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
last.1.pdb :
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb
trajectory.2.pdb:
https://www.dropbox.com/s/ncuwqbgsecww8 ... tory.2.pdb
last.2.pdb:
https://www.dropbox.com/s/e2zqqq0ecrelzxu/last.2.pdb
model-native.pdb
https://www.dropbox.com/s/t1sbi1rx3qfm0 ... native.pdb
template.pdb:
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb
model-before-MMB-run
https://www.dropbox.com/s/23snpa4fqcaji ... MB-run.pdb
In the trajectory.2.pdb and last.2.pdb we see that the model did try to take a conformation but the result is not satisfactory.
Apart from threaded regions, the insertions/deletion regions that were well modeled were affected by MMB run, so in this next run (command file below) I am trying to rigidify all the regions of model chain A except for the regions I want to model well.
Please let me know if you think this command file could be improved to serve the purpose.
New command file:
# Put chain B in last.1.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
mobilizer Rigid A 33 102 # want only region 1-32 to be remodeled
mobilizer Rigid A 139 229 # want only region 103-138 to be remodeled
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 139 Superimpose B 176 Superimpose Cis
baseInteraction A 140 Superimpose B 177 Superimpose Cis
baseInteraction A 141 Superimpose B 178 Superimpose Cis
baseInteraction A 142 Superimpose B 179 Superimpose Cis
baseInteraction A 143 Superimpose B 180 Superimpose Cis
baseInteraction A 144 Superimpose B 181 Superimpose Cis
baseInteraction A 145 Superimpose B 182 Superimpose Cis
baseInteraction A 146 Superimpose B 183 Superimpose Cis
baseInteraction A 147 Superimpose B 184 Superimpose Cis
baseInteraction A 148 Superimpose B 185 Superimpose Cis
baseInteraction A 149 Superimpose B 186 Superimpose Cis
baseInteraction A 150 Superimpose B 187 Superimpose Cis
baseInteraction A 151 Superimpose B 188 Superimpose Cis
baseInteraction A 152 Superimpose B 189 Superimpose Cis
baseInteraction A 153 Superimpose B 190 Superimpose Cis
baseInteraction A 154 Superimpose B 191 Superimpose Cis
baseInteraction A 155 Superimpose B 192 Superimpose Cis
baseInteraction A 156 Superimpose B 193 Superimpose Cis
baseInteraction A 157 Superimpose B 194 Superimpose Cis
baseInteraction A 158 Superimpose B 195 Superimpose Cis
baseInteraction A 159 Superimpose B 196 Superimpose Cis
baseInteraction A 160 Superimpose B 197 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
Thanks
cheers!
-
Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
The threading is not finished, you need to give it more time. Don't throw away your results, just start from stage 3, like this:
firstStage 3
lastStage 3
this will use the structure you had at the end of stage 2, last.2.pdb, as a starting point.
The baseInteraction's you added are good, they should make the base orientation better.
I would wait until that is done, then see how the insertions/deletions (indels) are modeled. I think they could be modeled by specifying the base pairing interactions, as you were trying to do at the very beginning. But let's wait for that, until after your threading is done.
Sam
firstStage 3
lastStage 3
this will use the structure you had at the end of stage 2, last.2.pdb, as a starting point.
The baseInteraction's you added are good, they should make the base orientation better.
I would wait until that is done, then see how the insertions/deletions (indels) are modeled. I think they could be modeled by specifying the base pairing interactions, as you were trying to do at the very beginning. But let's wait for that, until after your threading is done.
Sam
-
Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
is this going into a scientific paper by the way? what is your goal?
-
Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
yes this work will go for publication but this is the sanity test i am performing before going to the real modeling . This will serve as the benchmark of the procedures I use to make a model which could be useful to do modeling for unavailable structures. The goal is to generate models for few families of RNAs.
The new command file modified based on your suggestion is this : please let me know if it is fine:
firstStage 3
lastStage 3
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
#"threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
#mobilizer Rigid A 33 102 commented for further threading to continue
#mobilizer Rigid A 139 229 commented for further threading to continue
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 139 Superimpose B 176 Superimpose Cis
baseInteraction A 140 Superimpose B 177 Superimpose Cis
baseInteraction A 141 Superimpose B 178 Superimpose Cis
baseInteraction A 142 Superimpose B 179 Superimpose Cis
baseInteraction A 143 Superimpose B 180 Superimpose Cis
baseInteraction A 144 Superimpose B 181 Superimpose Cis
baseInteraction A 145 Superimpose B 182 Superimpose Cis
baseInteraction A 146 Superimpose B 183 Superimpose Cis
baseInteraction A 147 Superimpose B 184 Superimpose Cis
baseInteraction A 148 Superimpose B 185 Superimpose Cis
baseInteraction A 149 Superimpose B 186 Superimpose Cis
baseInteraction A 150 Superimpose B 187 Superimpose Cis
baseInteraction A 151 Superimpose B 188 Superimpose Cis
baseInteraction A 152 Superimpose B 189 Superimpose Cis
baseInteraction A 153 Superimpose B 190 Superimpose Cis
baseInteraction A 154 Superimpose B 191 Superimpose Cis
baseInteraction A 155 Superimpose B 192 Superimpose Cis
baseInteraction A 156 Superimpose B 193 Superimpose Cis
baseInteraction A 157 Superimpose B 194 Superimpose Cis
baseInteraction A 158 Superimpose B 195 Superimpose Cis
baseInteraction A 159 Superimpose B 196 Superimpose Cis
baseInteraction A 160 Superimpose B 197 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
thanks
cheers!
The new command file modified based on your suggestion is this : please let me know if it is fine:
firstStage 3
lastStage 3
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
#"threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300
#mobilizer Rigid A 33 102 commented for further threading to continue
#mobilizer Rigid A 139 229 commented for further threading to continue
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 139 Superimpose B 176 Superimpose Cis
baseInteraction A 140 Superimpose B 177 Superimpose Cis
baseInteraction A 141 Superimpose B 178 Superimpose Cis
baseInteraction A 142 Superimpose B 179 Superimpose Cis
baseInteraction A 143 Superimpose B 180 Superimpose Cis
baseInteraction A 144 Superimpose B 181 Superimpose Cis
baseInteraction A 145 Superimpose B 182 Superimpose Cis
baseInteraction A 146 Superimpose B 183 Superimpose Cis
baseInteraction A 147 Superimpose B 184 Superimpose Cis
baseInteraction A 148 Superimpose B 185 Superimpose Cis
baseInteraction A 149 Superimpose B 186 Superimpose Cis
baseInteraction A 150 Superimpose B 187 Superimpose Cis
baseInteraction A 151 Superimpose B 188 Superimpose Cis
baseInteraction A 152 Superimpose B 189 Superimpose Cis
baseInteraction A 153 Superimpose B 190 Superimpose Cis
baseInteraction A 154 Superimpose B 191 Superimpose Cis
baseInteraction A 155 Superimpose B 192 Superimpose Cis
baseInteraction A 156 Superimpose B 193 Superimpose Cis
baseInteraction A 157 Superimpose B 194 Superimpose Cis
baseInteraction A 158 Superimpose B 195 Superimpose Cis
baseInteraction A 159 Superimpose B 196 Superimpose Cis
baseInteraction A 160 Superimpose B 197 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
thanks
cheers!