parameters.csv file for RNA modeling
- Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
You have to have a strategy for how you will form the structure. Firstly, you are mucking up the region 103-137, which was already pretty good, in order to rearrange a couple of residues at the base of the stem-loop. I would flexibilize only those residues that have to be flexible. My guess is you need 37, 136, and 137. Maybe also 104, if you think the helix needs to move (it probably does). You might want to fix all the fragments except the stem-loop, to ground (with the constraint command, see earlier message).
Then think about what you think those residues are doing. 37 looks like it's interacting with 137 currently. Are you sure it should interact with 136? If so, think about how you think the residues should rearrange in this area.
I have no idea why you also flexibilized 188-219, which is quite distant. You should make a new command file that gets rid of almost all these interactions, reduces the flexibility as described, and constrains everything to ground except for the stem-loop of interest (38 to 135 or so).
It might be necessary to turn on physics around residues 37, 136, and 137, but maybe we should let you work with the above for a bit first.
Sam
Then think about what you think those residues are doing. 37 looks like it's interacting with 137 currently. Are you sure it should interact with 136? If so, think about how you think the residues should rearrange in this area.
I have no idea why you also flexibilized 188-219, which is quite distant. You should make a new command file that gets rid of almost all these interactions, reduces the flexibility as described, and constrains everything to ground except for the stem-loop of interest (38 to 135 or so).
It might be necessary to turn on physics around residues 37, 136, and 137, but maybe we should let you work with the above for a bit first.
Sam
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Thanks much Sam.
I am on to it. will send you the results once its finished.
By this you mean:
"and constrains everything to ground except for the stem-loop of interest (38 to 135 or so)."
I guess you mean to say 103-137 because the stem loop is in this region.
cheers!
I am on to it. will send you the results once its finished.
By this you mean:
"and constrains everything to ground except for the stem-loop of interest (38 to 135 or so)."
I guess you mean to say 103-137 because the stem loop is in this region.
cheers!
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Hi Sam,
Here is the command file I have prepared for the region 103-137
I have made only the residues 37, 136, 137 and 104 flexible.
Also, have constrained all the residues to ground except for 103-137 .
Please let me know what you think about this command file.
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
constraint A 1 Weld Ground
constraint A 2 Weld Ground
constraint A 3 Weld Ground
constraint A 4 Weld Ground
constraint A 5 Weld Ground
constraint A 6 Weld Ground
constraint A 7 Weld Ground
constraint A 8 Weld Ground
constraint A 9 Weld Ground
constraint A 10 Weld Ground
constraint A 11 Weld Ground
constraint A 12 Weld Ground
constraint A 13 Weld Ground
constraint A 14 Weld Ground
constraint A 15 Weld Ground
constraint A 16 Weld Ground
constraint A 17 Weld Ground
constraint A 18 Weld Ground
constraint A 19 Weld Ground
constraint A 20 Weld Ground
constraint A 21 Weld Ground
constraint A 22 Weld Ground
constraint A 23 Weld Ground
constraint A 24 Weld Ground
constraint A 25 Weld Ground
constraint A 26 Weld Ground
constraint A 27 Weld Ground
constraint A 28 Weld Ground
constraint A 29 Weld Ground
constraint A 30 Weld Ground
constraint A 31 Weld Ground
constraint A 32 Weld Ground
constraint A 33 Weld Ground
constraint A 34 Weld Ground
constraint A 35 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 39 Weld Ground
constraint A 40 Weld Ground
constraint A 41 Weld Ground
constraint A 42 Weld Ground
constraint A 43 Weld Ground
constraint A 44 Weld Ground
constraint A 45 Weld Ground
constraint A 46 Weld Ground
constraint A 47 Weld Ground
constraint A 48 Weld Ground
constraint A 49 Weld Ground
constraint A 50 Weld Ground
constraint A 51 Weld Ground
constraint A 52 Weld Ground
constraint A 53 Weld Ground
constraint A 54 Weld Ground
constraint A 55 Weld Ground
constraint A 56 Weld Ground
constraint A 57 Weld Ground
constraint A 58 Weld Ground
constraint A 59 Weld Ground
constraint A 60 Weld Ground
constraint A 61 Weld Ground
constraint A 62 Weld Ground
constraint A 63 Weld Ground
constraint A 64 Weld Ground
constraint A 65 Weld Ground
constraint A 66 Weld Ground
constraint A 67 Weld Ground
constraint A 68 Weld Ground
constraint A 69 Weld Ground
constraint A 70 Weld Ground
constraint A 71 Weld Ground
constraint A 72 Weld Ground
constraint A 73 Weld Ground
constraint A 74 Weld Ground
constraint A 75 Weld Ground
constraint A 76 Weld Ground
constraint A 77 Weld Ground
constraint A 78 Weld Ground
constraint A 79 Weld Ground
constraint A 80 Weld Ground
constraint A 81 Weld Ground
constraint A 82 Weld Ground
constraint A 83 Weld Ground
constraint A 84 Weld Ground
constraint A 85 Weld Ground
constraint A 86 Weld Ground
constraint A 87 Weld Ground
constraint A 88 Weld Ground
constraint A 89 Weld Ground
constraint A 90 Weld Ground
constraint A 91 Weld Ground
constraint A 92 Weld Ground
constraint A 93 Weld Ground
constraint A 94 Weld Ground
constraint A 95 Weld Ground
constraint A 96 Weld Ground
constraint A 97 Weld Ground
constraint A 98 Weld Ground
constraint A 99 Weld Ground
constraint A 100 Weld Ground
constraint A 101 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 139 Weld Ground
constraint A 140 Weld Ground
constraint A 141 Weld Ground
constraint A 142 Weld Ground
constraint A 143 Weld Ground
constraint A 144 Weld Ground
constraint A 145 Weld Ground
constraint A 146 Weld Ground
constraint A 147 Weld Ground
constraint A 148 Weld Ground
constraint A 149 Weld Ground
constraint A 150 Weld Ground
constraint A 151 Weld Ground
constraint A 152 Weld Ground
constraint A 153 Weld Ground
constraint A 154 Weld Ground
constraint A 155 Weld Ground
constraint A 156 Weld Ground
constraint A 157 Weld Ground
constraint A 158 Weld Ground
constraint A 159 Weld Ground
constraint A 160 Weld Ground
constraint A 161 Weld Ground
constraint A 162 Weld Ground
constraint A 163 Weld Ground
constraint A 164 Weld Ground
constraint A 165 Weld Ground
constraint A 166 Weld Ground
constraint A 167 Weld Ground
constraint A 168 Weld Ground
constraint A 169 Weld Ground
constraint A 170 Weld Ground
constraint A 171 Weld Ground
constraint A 172 Weld Ground
constraint A 173 Weld Ground
constraint A 174 Weld Ground
constraint A 175 Weld Ground
constraint A 176 Weld Ground
constraint A 177 Weld Ground
constraint A 178 Weld Ground
constraint A 179 Weld Ground
constraint A 180 Weld Ground
constraint A 181 Weld Ground
constraint A 182 Weld Ground
constraint A 183 Weld Ground
constraint A 184 Weld Ground
constraint A 185 Weld Ground
constraint A 186 Weld Ground
constraint A 187 Weld Ground
constraint A 188 Weld Ground
constraint A 189 Weld Ground
constraint A 190 Weld Ground
constraint A 191 Weld Ground
constraint A 192 Weld Ground
constraint A 193 Weld Ground
constraint A 194 Weld Ground
constraint A 195 Weld Ground
constraint A 196 Weld Ground
constraint A 197 Weld Ground
constraint A 198 Weld Ground
constraint A 199 Weld Ground
constraint A 200 Weld Ground
constraint A 201 Weld Ground
constraint A 202 Weld Ground
constraint A 203 Weld Ground
constraint A 204 Weld Ground
constraint A 205 Weld Ground
constraint A 206 Weld Ground
constraint A 207 Weld Ground
constraint A 208 Weld Ground
constraint A 209 Weld Ground
constraint A 210 Weld Ground
constraint A 211 Weld Ground
constraint A 212 Weld Ground
constraint A 213 Weld Ground
constraint A 214 Weld Ground
constraint A 215 Weld Ground
constraint A 216 Weld Ground
constraint A 217 Weld Ground
constraint A 218 Weld Ground
constraint A 219 Weld Ground
constraint A 220 Weld Ground
constraint A 221 Weld Ground
constraint A 222 Weld Ground
constraint A 223 Weld Ground
constraint A 224 Weld Ground
constraint A 225 Weld Ground
constraint A 226 Weld Ground
constraint A 227 Weld Ground
constraint A 228 Weld Ground
constraint A 229 Weld Ground
#contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 70.0
#Threading forces
threading A 30 50 B 1 21 300
threading A 51 80 B 104 133 300
threading A 81 104 B 150 173 300
threading A 136 148 B 174 186 300
threading A 149 189 B 195 235 300
threading A 218 229 B 236 247 300
#baseInteraction A 5 WatsonCrick A 26 WatsonCrick Cis
#baseInteraction A 6 WatsonCrick A 25 WatsonCrick Cis
#baseInteraction A 7 WatsonCrick A 24 WatsonCrick Cis
#baseInteraction A 8 WatsonCrick A 23 WatsonCrick Cis
#baseInteraction A 9 WatsonCrick A 22 WatsonCrick Cis
#baseInteraction A 10 WatsonCrick A 21 WatsonCrick Cis
#baseInteraction A 11 WatsonCrick A 20 WatsonCrick Cis
#baseInteraction A 12 WatsonCrick A 19 WatsonCrick Cis
#baseInteraction A 13 WatsonCrick A 18 WatsonCrick Cis
#baseInteraction A 149 WatsonCrick A 153 WatsonCrick Cis
#baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
#baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
#baseInteraction A 105 WatsonCrick A 114 WatsonCrick Cis
#baseInteraction A 106 WatsonCrick A 113 WatsonCrick Cis
#baseInteraction A 107 WatsonCrick A 112 WatsonCrick Cis
#baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
#baseInteraction A 117 WatsonCrick A 134 WatsonCrick Cis
#baseInteraction A 118 WatsonCrick A 133 WatsonCrick Cis
#baseInteraction A 119 WatsonCrick A 132 WatsonCrick Cis
#baseInteraction A 120 WatsonCrick A 131 WatsonCrick Cis
#baseInteraction A 121 WatsonCrick A 130 WatsonCrick Cis
#baseInteraction A 122 WatsonCrick A 129 WatsonCrick Cis
#baseInteraction A 123 WatsonCrick A 128 WatsonCrick Cis
#baseInteraction A 188 WatsonCrick A 179 WatsonCrick Cis
#baseInteraction A 189 WatsonCrick A 178 WatsonCrick Cis
#baseInteraction A 190 WatsonCrick A 177 WatsonCrick Cis
#baseInteraction A 191 WatsonCrick A 176 WatsonCrick Cis
#baseInteraction A 195 WatsonCrick A 217 WatsonCrick Cis
#baseInteraction A 196 WatsonCrick A 216 WatsonCrick Cis
#baseInteraction A 197 WatsonCrick A 215 WatsonCrick Cis
#baseInteraction A 198 WatsonCrick A 214 WatsonCrick Cis
#baseInteraction A 199 WatsonCrick A 213 WatsonCrick Cis
#baseInteraction A 200 WatsonCrick A 212 WatsonCrick Cis
#baseInteraction A 201 WatsonCrick A 211 WatsonCrick Cis
baseInteraction A 30 Superimpose B 1 Superimpose Cis
baseInteraction A 31 Superimpose B 2 Superimpose Cis
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 49 Superimpose B 20 Superimpose Cis
baseInteraction A 50 Superimpose B 21 Superimpose Cis
baseInteraction A 51 Superimpose B 104 Superimpose Cis
baseInteraction A 52 Superimpose B 105 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 79 Superimpose B 132 Superimpose Cis
baseInteraction A 80 Superimpose B 133 Superimpose Cis
baseInteraction A 81 Superimpose B 150 Superimpose Cis
baseInteraction A 82 Superimpose B 151 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 103 Superimpose B 172 Superimpose Cis
baseInteraction A 104 Superimpose B 173 Superimpose Cis
baseInteraction A 136 Superimpose B 174 Superimpose Cis
baseInteraction A 137 Superimpose B 175 Superimpose Cis
baseInteraction A 138 Superimpose B 176 Superimpose Cis
baseInteraction A 139 Superimpose B 177 Superimpose Cis
baseInteraction A 140 Superimpose B 178 Superimpose Cis
baseInteraction A 141 Superimpose B 179 Superimpose Cis
baseInteraction A 142 Superimpose B 180 Superimpose Cis
baseInteraction A 143 Superimpose B 181 Superimpose Cis
baseInteraction A 144 Superimpose B 182 Superimpose Cis
baseInteraction A 145 Superimpose B 183 Superimpose Cis
baseInteraction A 146 Superimpose B 184 Superimpose Cis
baseInteraction A 147 Superimpose B 185 Superimpose Cis
baseInteraction A 148 Superimpose B 186 Superimpose Cis
baseInteraction A 149 Superimpose B 195 Superimpose Cis
baseInteraction A 150 Superimpose B 196 Superimpose Cis
baseInteraction A 151 Superimpose B 197 Superimpose Cis
baseInteraction A 152 Superimpose B 198 Superimpose Cis
baseInteraction A 153 Superimpose B 199 Superimpose Cis
baseInteraction A 154 Superimpose B 200 Superimpose Cis
baseInteraction A 155 Superimpose B 201 Superimpose Cis
baseInteraction A 156 Superimpose B 202 Superimpose Cis
baseInteraction A 157 Superimpose B 203 Superimpose Cis
baseInteraction A 158 Superimpose B 204 Superimpose Cis
baseInteraction A 159 Superimpose B 205 Superimpose Cis
baseInteraction A 160 Superimpose B 206 Superimpose Cis
baseInteraction A 161 Superimpose B 207 Superimpose Cis
baseInteraction A 162 Superimpose B 208 Superimpose Cis
baseInteraction A 163 Superimpose B 209 Superimpose Cis
baseInteraction A 164 Superimpose B 210 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 188 Superimpose B 234 Superimpose Cis
baseInteraction A 189 Superimpose B 235 Superimpose Cis
baseInteraction A 218 Superimpose B 236 Superimpose Cis
baseInteraction A 219 Superimpose B 237 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
Here is the command file I have prepared for the region 103-137
I have made only the residues 37, 136, 137 and 104 flexible.
Also, have constrained all the residues to ground except for 103-137 .
Please let me know what you think about this command file.
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
constraint A 1 Weld Ground
constraint A 2 Weld Ground
constraint A 3 Weld Ground
constraint A 4 Weld Ground
constraint A 5 Weld Ground
constraint A 6 Weld Ground
constraint A 7 Weld Ground
constraint A 8 Weld Ground
constraint A 9 Weld Ground
constraint A 10 Weld Ground
constraint A 11 Weld Ground
constraint A 12 Weld Ground
constraint A 13 Weld Ground
constraint A 14 Weld Ground
constraint A 15 Weld Ground
constraint A 16 Weld Ground
constraint A 17 Weld Ground
constraint A 18 Weld Ground
constraint A 19 Weld Ground
constraint A 20 Weld Ground
constraint A 21 Weld Ground
constraint A 22 Weld Ground
constraint A 23 Weld Ground
constraint A 24 Weld Ground
constraint A 25 Weld Ground
constraint A 26 Weld Ground
constraint A 27 Weld Ground
constraint A 28 Weld Ground
constraint A 29 Weld Ground
constraint A 30 Weld Ground
constraint A 31 Weld Ground
constraint A 32 Weld Ground
constraint A 33 Weld Ground
constraint A 34 Weld Ground
constraint A 35 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 39 Weld Ground
constraint A 40 Weld Ground
constraint A 41 Weld Ground
constraint A 42 Weld Ground
constraint A 43 Weld Ground
constraint A 44 Weld Ground
constraint A 45 Weld Ground
constraint A 46 Weld Ground
constraint A 47 Weld Ground
constraint A 48 Weld Ground
constraint A 49 Weld Ground
constraint A 50 Weld Ground
constraint A 51 Weld Ground
constraint A 52 Weld Ground
constraint A 53 Weld Ground
constraint A 54 Weld Ground
constraint A 55 Weld Ground
constraint A 56 Weld Ground
constraint A 57 Weld Ground
constraint A 58 Weld Ground
constraint A 59 Weld Ground
constraint A 60 Weld Ground
constraint A 61 Weld Ground
constraint A 62 Weld Ground
constraint A 63 Weld Ground
constraint A 64 Weld Ground
constraint A 65 Weld Ground
constraint A 66 Weld Ground
constraint A 67 Weld Ground
constraint A 68 Weld Ground
constraint A 69 Weld Ground
constraint A 70 Weld Ground
constraint A 71 Weld Ground
constraint A 72 Weld Ground
constraint A 73 Weld Ground
constraint A 74 Weld Ground
constraint A 75 Weld Ground
constraint A 76 Weld Ground
constraint A 77 Weld Ground
constraint A 78 Weld Ground
constraint A 79 Weld Ground
constraint A 80 Weld Ground
constraint A 81 Weld Ground
constraint A 82 Weld Ground
constraint A 83 Weld Ground
constraint A 84 Weld Ground
constraint A 85 Weld Ground
constraint A 86 Weld Ground
constraint A 87 Weld Ground
constraint A 88 Weld Ground
constraint A 89 Weld Ground
constraint A 90 Weld Ground
constraint A 91 Weld Ground
constraint A 92 Weld Ground
constraint A 93 Weld Ground
constraint A 94 Weld Ground
constraint A 95 Weld Ground
constraint A 96 Weld Ground
constraint A 97 Weld Ground
constraint A 98 Weld Ground
constraint A 99 Weld Ground
constraint A 100 Weld Ground
constraint A 101 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 139 Weld Ground
constraint A 140 Weld Ground
constraint A 141 Weld Ground
constraint A 142 Weld Ground
constraint A 143 Weld Ground
constraint A 144 Weld Ground
constraint A 145 Weld Ground
constraint A 146 Weld Ground
constraint A 147 Weld Ground
constraint A 148 Weld Ground
constraint A 149 Weld Ground
constraint A 150 Weld Ground
constraint A 151 Weld Ground
constraint A 152 Weld Ground
constraint A 153 Weld Ground
constraint A 154 Weld Ground
constraint A 155 Weld Ground
constraint A 156 Weld Ground
constraint A 157 Weld Ground
constraint A 158 Weld Ground
constraint A 159 Weld Ground
constraint A 160 Weld Ground
constraint A 161 Weld Ground
constraint A 162 Weld Ground
constraint A 163 Weld Ground
constraint A 164 Weld Ground
constraint A 165 Weld Ground
constraint A 166 Weld Ground
constraint A 167 Weld Ground
constraint A 168 Weld Ground
constraint A 169 Weld Ground
constraint A 170 Weld Ground
constraint A 171 Weld Ground
constraint A 172 Weld Ground
constraint A 173 Weld Ground
constraint A 174 Weld Ground
constraint A 175 Weld Ground
constraint A 176 Weld Ground
constraint A 177 Weld Ground
constraint A 178 Weld Ground
constraint A 179 Weld Ground
constraint A 180 Weld Ground
constraint A 181 Weld Ground
constraint A 182 Weld Ground
constraint A 183 Weld Ground
constraint A 184 Weld Ground
constraint A 185 Weld Ground
constraint A 186 Weld Ground
constraint A 187 Weld Ground
constraint A 188 Weld Ground
constraint A 189 Weld Ground
constraint A 190 Weld Ground
constraint A 191 Weld Ground
constraint A 192 Weld Ground
constraint A 193 Weld Ground
constraint A 194 Weld Ground
constraint A 195 Weld Ground
constraint A 196 Weld Ground
constraint A 197 Weld Ground
constraint A 198 Weld Ground
constraint A 199 Weld Ground
constraint A 200 Weld Ground
constraint A 201 Weld Ground
constraint A 202 Weld Ground
constraint A 203 Weld Ground
constraint A 204 Weld Ground
constraint A 205 Weld Ground
constraint A 206 Weld Ground
constraint A 207 Weld Ground
constraint A 208 Weld Ground
constraint A 209 Weld Ground
constraint A 210 Weld Ground
constraint A 211 Weld Ground
constraint A 212 Weld Ground
constraint A 213 Weld Ground
constraint A 214 Weld Ground
constraint A 215 Weld Ground
constraint A 216 Weld Ground
constraint A 217 Weld Ground
constraint A 218 Weld Ground
constraint A 219 Weld Ground
constraint A 220 Weld Ground
constraint A 221 Weld Ground
constraint A 222 Weld Ground
constraint A 223 Weld Ground
constraint A 224 Weld Ground
constraint A 225 Weld Ground
constraint A 226 Weld Ground
constraint A 227 Weld Ground
constraint A 228 Weld Ground
constraint A 229 Weld Ground
#contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 70.0
#Threading forces
threading A 30 50 B 1 21 300
threading A 51 80 B 104 133 300
threading A 81 104 B 150 173 300
threading A 136 148 B 174 186 300
threading A 149 189 B 195 235 300
threading A 218 229 B 236 247 300
#baseInteraction A 5 WatsonCrick A 26 WatsonCrick Cis
#baseInteraction A 6 WatsonCrick A 25 WatsonCrick Cis
#baseInteraction A 7 WatsonCrick A 24 WatsonCrick Cis
#baseInteraction A 8 WatsonCrick A 23 WatsonCrick Cis
#baseInteraction A 9 WatsonCrick A 22 WatsonCrick Cis
#baseInteraction A 10 WatsonCrick A 21 WatsonCrick Cis
#baseInteraction A 11 WatsonCrick A 20 WatsonCrick Cis
#baseInteraction A 12 WatsonCrick A 19 WatsonCrick Cis
#baseInteraction A 13 WatsonCrick A 18 WatsonCrick Cis
#baseInteraction A 149 WatsonCrick A 153 WatsonCrick Cis
#baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
#baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
#baseInteraction A 105 WatsonCrick A 114 WatsonCrick Cis
#baseInteraction A 106 WatsonCrick A 113 WatsonCrick Cis
#baseInteraction A 107 WatsonCrick A 112 WatsonCrick Cis
#baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
#baseInteraction A 117 WatsonCrick A 134 WatsonCrick Cis
#baseInteraction A 118 WatsonCrick A 133 WatsonCrick Cis
#baseInteraction A 119 WatsonCrick A 132 WatsonCrick Cis
#baseInteraction A 120 WatsonCrick A 131 WatsonCrick Cis
#baseInteraction A 121 WatsonCrick A 130 WatsonCrick Cis
#baseInteraction A 122 WatsonCrick A 129 WatsonCrick Cis
#baseInteraction A 123 WatsonCrick A 128 WatsonCrick Cis
#baseInteraction A 188 WatsonCrick A 179 WatsonCrick Cis
#baseInteraction A 189 WatsonCrick A 178 WatsonCrick Cis
#baseInteraction A 190 WatsonCrick A 177 WatsonCrick Cis
#baseInteraction A 191 WatsonCrick A 176 WatsonCrick Cis
#baseInteraction A 195 WatsonCrick A 217 WatsonCrick Cis
#baseInteraction A 196 WatsonCrick A 216 WatsonCrick Cis
#baseInteraction A 197 WatsonCrick A 215 WatsonCrick Cis
#baseInteraction A 198 WatsonCrick A 214 WatsonCrick Cis
#baseInteraction A 199 WatsonCrick A 213 WatsonCrick Cis
#baseInteraction A 200 WatsonCrick A 212 WatsonCrick Cis
#baseInteraction A 201 WatsonCrick A 211 WatsonCrick Cis
baseInteraction A 30 Superimpose B 1 Superimpose Cis
baseInteraction A 31 Superimpose B 2 Superimpose Cis
baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 49 Superimpose B 20 Superimpose Cis
baseInteraction A 50 Superimpose B 21 Superimpose Cis
baseInteraction A 51 Superimpose B 104 Superimpose Cis
baseInteraction A 52 Superimpose B 105 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 79 Superimpose B 132 Superimpose Cis
baseInteraction A 80 Superimpose B 133 Superimpose Cis
baseInteraction A 81 Superimpose B 150 Superimpose Cis
baseInteraction A 82 Superimpose B 151 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 103 Superimpose B 172 Superimpose Cis
baseInteraction A 104 Superimpose B 173 Superimpose Cis
baseInteraction A 136 Superimpose B 174 Superimpose Cis
baseInteraction A 137 Superimpose B 175 Superimpose Cis
baseInteraction A 138 Superimpose B 176 Superimpose Cis
baseInteraction A 139 Superimpose B 177 Superimpose Cis
baseInteraction A 140 Superimpose B 178 Superimpose Cis
baseInteraction A 141 Superimpose B 179 Superimpose Cis
baseInteraction A 142 Superimpose B 180 Superimpose Cis
baseInteraction A 143 Superimpose B 181 Superimpose Cis
baseInteraction A 144 Superimpose B 182 Superimpose Cis
baseInteraction A 145 Superimpose B 183 Superimpose Cis
baseInteraction A 146 Superimpose B 184 Superimpose Cis
baseInteraction A 147 Superimpose B 185 Superimpose Cis
baseInteraction A 148 Superimpose B 186 Superimpose Cis
baseInteraction A 149 Superimpose B 195 Superimpose Cis
baseInteraction A 150 Superimpose B 196 Superimpose Cis
baseInteraction A 151 Superimpose B 197 Superimpose Cis
baseInteraction A 152 Superimpose B 198 Superimpose Cis
baseInteraction A 153 Superimpose B 199 Superimpose Cis
baseInteraction A 154 Superimpose B 200 Superimpose Cis
baseInteraction A 155 Superimpose B 201 Superimpose Cis
baseInteraction A 156 Superimpose B 202 Superimpose Cis
baseInteraction A 157 Superimpose B 203 Superimpose Cis
baseInteraction A 158 Superimpose B 204 Superimpose Cis
baseInteraction A 159 Superimpose B 205 Superimpose Cis
baseInteraction A 160 Superimpose B 206 Superimpose Cis
baseInteraction A 161 Superimpose B 207 Superimpose Cis
baseInteraction A 162 Superimpose B 208 Superimpose Cis
baseInteraction A 163 Superimpose B 209 Superimpose Cis
baseInteraction A 164 Superimpose B 210 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 188 Superimpose B 234 Superimpose Cis
baseInteraction A 189 Superimpose B 235 Superimpose Cis
baseInteraction A 218 Superimpose B 236 Superimpose Cis
baseInteraction A 219 Superimpose B 237 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis
- Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
You can't constrain more than one residue per rigid stretch. Each rigid stretch is a single body and can only be constrained to ground once. Just do
constrain A 1 Weld Ground
constrain A 38 Weld Ground
..etc.
But more importantly, you are not doing anything with residues 136 and 37 !!!! MMB doesn't read your mind, it just does what you tell it to do. Do you want these to base pair? Then tell MMB to do this. You are at a stage where thinking about what you want is the most important thing.
Also, you still have lots of "threading" and "baseInteraction" commands that you don't need. This will just confuse you! Delete them. things that are rigid and constrained to ground are not going anywhere.
Sam
constrain A 1 Weld Ground
constrain A 38 Weld Ground
..etc.
But more importantly, you are not doing anything with residues 136 and 37 !!!! MMB doesn't read your mind, it just does what you tell it to do. Do you want these to base pair? Then tell MMB to do this. You are at a stage where thinking about what you want is the most important thing.
Also, you still have lots of "threading" and "baseInteraction" commands that you don't need. This will just confuse you! Delete them. things that are rigid and constrained to ground are not going anywhere.
Sam
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
hi Sam,
I understand what you meant. I have modified the command file.
I would like to mention that i noticed that the interactions mentioned in the SS pdf file for region 103-137 are different from that of interactions already present in model. for example :
in model 130 interacts with 111 whereas in SS notation
130 interacts with 121
Like this the other interaction are also miinterpreted in the model. This could be the reason for the present conformation of the helix. So I have done this in the command file to have the correct interactions as per SS notation which could bring the right conformation to this region :
I have deleted the residues 104-135 from the pdb file and did this in command file:
# Put last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 103 Weld Ground
constraint A 138 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
mobilizer Rigid
mobilizer Default A 104 135
singleBondMobility A 103 O3* Free A 104 P
singleBondMobility A 104 O3* Free A 105 P
singleBondMobility A 105 O3* Free A 106 P
singleBondMobility A 106 O3* Free A 107 P
singleBondMobility A 107 O3* Free A 108 P
singleBondMobility A 108 O3* Free A 109 P
singleBondMobility A 109 O3* Free A 110 P
singleBondMobility A 110 O3* Free A 111 P
singleBondMobility A 111 O3* Free A 112 P
singleBondMobility A 112 O3* Free A 113 P
singleBondMobility A 113 O3* Free A 114 P
singleBondMobility A 114 O3* Free A 115 P
singleBondMobility A 115 O3* Free A 116 P
singleBondMobility A 116 O3* Free A 117 P
singleBondMobility A 117 O3* Free A 118 P
singleBondMobility A 118 O3* Free A 119 P
singleBondMobility A 119 O3* Free A 120 P
singleBondMobility A 120 O3* Free A 121 P
singleBondMobility A 121 O3* Free A 122 P
singleBondMobility A 122 O3* Free A 123 P
singleBondMobility A 123 O3* Free A 124 P
singleBondMobility A 124 O3* Free A 125 P
singleBondMobility A 125 O3* Free A 126 P
singleBondMobility A 126 O3* Free A 127 P
singleBondMobility A 127 O3* Free A 128 P
singleBondMobility A 128 O3* Free A 129 P
singleBondMobility A 129 O3* Free A 130 P
singleBondMobility A 130 O3* Free A 131 P
singleBondMobility A 131 O3* Free A 132 P
singleBondMobility A 132 O3* Free A 133 P
singleBondMobility A 133 O3* Free A 134 P
singleBondMobility A 134 O3* Free A 135 P
singleBondMobility A 135 O3* Free A 136 P
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
baseInteraction A 105 WatsonCrick A 114 WatsonCrick Cis
baseInteraction A 106 WatsonCrick A 113 WatsonCrick Cis
baseInteraction A 107 WatsonCrick A 112 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
baseInteraction A 117 WatsonCrick A 134 WatsonCrick Cis
baseInteraction A 118 WatsonCrick A 133 WatsonCrick Cis
baseInteraction A 119 WatsonCrick A 132 WatsonCrick Cis
baseInteraction A 120 WatsonCrick A 131 WatsonCrick Cis
baseInteraction A 121 WatsonCrick A 130 WatsonCrick Cis
baseInteraction A 122 WatsonCrick A 129 WatsonCrick Cis
baseInteraction A 123 WatsonCrick A 128 WatsonCrick Cis
Do you think this will work? or I should stick to the interactions present in the model last.3.pdb and do this :
# Put last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
Thanks
cheers!
Deepak
I understand what you meant. I have modified the command file.
I would like to mention that i noticed that the interactions mentioned in the SS pdf file for region 103-137 are different from that of interactions already present in model. for example :
in model 130 interacts with 111 whereas in SS notation
130 interacts with 121
Like this the other interaction are also miinterpreted in the model. This could be the reason for the present conformation of the helix. So I have done this in the command file to have the correct interactions as per SS notation which could bring the right conformation to this region :
I have deleted the residues 104-135 from the pdb file and did this in command file:
# Put last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 103 Weld Ground
constraint A 138 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
mobilizer Rigid
mobilizer Default A 104 135
singleBondMobility A 103 O3* Free A 104 P
singleBondMobility A 104 O3* Free A 105 P
singleBondMobility A 105 O3* Free A 106 P
singleBondMobility A 106 O3* Free A 107 P
singleBondMobility A 107 O3* Free A 108 P
singleBondMobility A 108 O3* Free A 109 P
singleBondMobility A 109 O3* Free A 110 P
singleBondMobility A 110 O3* Free A 111 P
singleBondMobility A 111 O3* Free A 112 P
singleBondMobility A 112 O3* Free A 113 P
singleBondMobility A 113 O3* Free A 114 P
singleBondMobility A 114 O3* Free A 115 P
singleBondMobility A 115 O3* Free A 116 P
singleBondMobility A 116 O3* Free A 117 P
singleBondMobility A 117 O3* Free A 118 P
singleBondMobility A 118 O3* Free A 119 P
singleBondMobility A 119 O3* Free A 120 P
singleBondMobility A 120 O3* Free A 121 P
singleBondMobility A 121 O3* Free A 122 P
singleBondMobility A 122 O3* Free A 123 P
singleBondMobility A 123 O3* Free A 124 P
singleBondMobility A 124 O3* Free A 125 P
singleBondMobility A 125 O3* Free A 126 P
singleBondMobility A 126 O3* Free A 127 P
singleBondMobility A 127 O3* Free A 128 P
singleBondMobility A 128 O3* Free A 129 P
singleBondMobility A 129 O3* Free A 130 P
singleBondMobility A 130 O3* Free A 131 P
singleBondMobility A 131 O3* Free A 132 P
singleBondMobility A 132 O3* Free A 133 P
singleBondMobility A 133 O3* Free A 134 P
singleBondMobility A 134 O3* Free A 135 P
singleBondMobility A 135 O3* Free A 136 P
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
baseInteraction A 105 WatsonCrick A 114 WatsonCrick Cis
baseInteraction A 106 WatsonCrick A 113 WatsonCrick Cis
baseInteraction A 107 WatsonCrick A 112 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
baseInteraction A 117 WatsonCrick A 134 WatsonCrick Cis
baseInteraction A 118 WatsonCrick A 133 WatsonCrick Cis
baseInteraction A 119 WatsonCrick A 132 WatsonCrick Cis
baseInteraction A 120 WatsonCrick A 131 WatsonCrick Cis
baseInteraction A 121 WatsonCrick A 130 WatsonCrick Cis
baseInteraction A 122 WatsonCrick A 129 WatsonCrick Cis
baseInteraction A 123 WatsonCrick A 128 WatsonCrick Cis
Do you think this will work? or I should stick to the interactions present in the model last.3.pdb and do this :
# Put last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 50
removeRigidBodyMomentum False
# "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
baseInteraction A 104 WatsonCrick A 115 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 136 WatsonCrick Cis
Thanks
cheers!
Deepak
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
hi Sam,
Here I have attached the result for the region 103-137 based on this command file:
# in last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 200
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 165 165
mobilizer Rigid
mobilizer Default A 103 103
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 164 Weld Ground
constraint A 166 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 137 WatsonCrick Cis
the files are :
last.3.pdb:
https://www.dropbox.com/s/u6gaynr1qfem24u/last.3.pdb
last.4.pdb:
https://www.dropbox.com/s/2n7irf7rcb8i4p8/last.4.pdb
trajectory.4.pdb:
https://www.dropbox.com/s/o76nwlwil3chw ... tory.4.pdb
we see that not much seems to be happening in the result.
Please let me know about your comments/suggestions. Also, if you could please have a look at the last message about my proposal of deleting the residues 103-137 and making the stem loop again and give your comments. I did that run and the result was not good, although the new base interactions seemed to be satisfied but the conformation of stem loop was not generated instead a cluttered region was formed with no conformation.
Thanks.
cheers!
Here I have attached the result for the region 103-137 based on this command file:
# in last.1.pdb
firstStage 4
lastStage 4
reportingInterval .5
numReportingIntervals 200
removeRigidBodyMomentum False
# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG
# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
mobilizer Rigid B
mobilizer Rigid
mobilizer Default A 136 136
mobilizer Rigid
mobilizer Default A 137 137
mobilizer Rigid
mobilizer Default A 104 104
mobilizer Rigid
mobilizer Default A 37 37
mobilizer Rigid
mobilizer Default A 165 165
mobilizer Rigid
mobilizer Default A 103 103
constraint A 1 Weld Ground
constraint A 36 Weld Ground
constraint A 38 Weld Ground
constraint A 102 Weld Ground
constraint A 138 Weld Ground
constraint A 164 Weld Ground
constraint A 166 Weld Ground
constraint A 229 Weld Ground
leontisWesthofInFileName parameters.csv
temperature 70.0
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 37 WatsonCrick A 137 WatsonCrick Cis
the files are :
last.3.pdb:
https://www.dropbox.com/s/u6gaynr1qfem24u/last.3.pdb
last.4.pdb:
https://www.dropbox.com/s/2n7irf7rcb8i4p8/last.4.pdb
trajectory.4.pdb:
https://www.dropbox.com/s/o76nwlwil3chw ... tory.4.pdb
we see that not much seems to be happening in the result.
Please let me know about your comments/suggestions. Also, if you could please have a look at the last message about my proposal of deleting the residues 103-137 and making the stem loop again and give your comments. I did that run and the result was not good, although the new base interactions seemed to be satisfied but the conformation of stem loop was not generated instead a cluttered region was formed with no conformation.
Thanks.
cheers!
- Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
I think your baseInteraction's are not strong enough. Try setting:
forceMultiplier 1000
See the reference guide for an explanation of what this does. If that's too strong you can try 20 or so.
forceMultiplier 1000
See the reference guide for an explanation of what this does. If that's too strong you can try 20 or so.
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Hi Sam,
I have been experimenting with the model with rnabuilder.
I was able to find a template for the region 1-32 though it was successfully folded but had clashes, so i remodeld this region with the second template whereas the template for the core remains the same.
The remodeled model is :
remodel-model.pdb:
https://www.dropbox.com/s/k2e64uut6fw6y ... -model.pdb
model-native.pdb: (native structure of model)
https://www.dropbox.com/s/t1sbi1rx3qfm0 ... native.pdb
template.pdb:
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb
It would be nice to have your comments on this model. I think this model is fine with the region 1-32 also solved with second template. The only region of concern that does not match the secondary structure information is 103-137 and it is because the tertiary interactions in the model are different from the ones mentioned in the secondary structure notation. the region 188-219 also seems to be good.
I tried with forcemultiplier and when compared the final model with regions 1-32, 188-219 and region 103-137 after using forcemultiplier with the native (to see the RMSD) , found that the region orientation of the region 103-137 is exactly opposite to what it is in native structure which makes the RMSd high, so I have left this region as it is in original model. the other two regions look good.
Now I think the only thing taht can be done to region 103-137 is to find a template and remodel it (which i tried to find but have not found yet) or simulate this region with secondary structure constraints to see if it can get an orientation close to native.
Please let me know about your comments/suggestion.
Thanks.
cheers!
I have been experimenting with the model with rnabuilder.
I was able to find a template for the region 1-32 though it was successfully folded but had clashes, so i remodeld this region with the second template whereas the template for the core remains the same.
The remodeled model is :
remodel-model.pdb:
https://www.dropbox.com/s/k2e64uut6fw6y ... -model.pdb
model-native.pdb: (native structure of model)
https://www.dropbox.com/s/t1sbi1rx3qfm0 ... native.pdb
template.pdb:
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb
It would be nice to have your comments on this model. I think this model is fine with the region 1-32 also solved with second template. The only region of concern that does not match the secondary structure information is 103-137 and it is because the tertiary interactions in the model are different from the ones mentioned in the secondary structure notation. the region 188-219 also seems to be good.
I tried with forcemultiplier and when compared the final model with regions 1-32, 188-219 and region 103-137 after using forcemultiplier with the native (to see the RMSD) , found that the region orientation of the region 103-137 is exactly opposite to what it is in native structure which makes the RMSd high, so I have left this region as it is in original model. the other two regions look good.
Now I think the only thing taht can be done to region 103-137 is to find a template and remodel it (which i tried to find but have not found yet) or simulate this region with secondary structure constraints to see if it can get an orientation close to native.
Please let me know about your comments/suggestion.
Thanks.
cheers!
- Samuel Flores
- Posts: 189
- Joined: Mon Apr 30, 2007 1:06 pm
Re: parameters.csv file for RNA modeling
It looks to me as though you have the secondary structure of 103-137 modeled reasonably (though I can't say whether it's correct). What you need is to figure out what's happening at the base of this stem-loop structure, what direction it's pointing in, etc. I also see a very long bond at residue 30. I would think you need to repair that, and this would also provide a useful constraint.
However it's hard for me to properly inspect the structure since it seems to have been generated with a different program -- the different atom count means I can't render it based on my prior clash-free structures. Please provide the MMB output in the future.
forceMultiplier is just a multiplying factor for the strength of the base-pairing forces. So if making it smaller improves the structures in your opinion, then the baseInteraction's are themselves suspect.
Don't know what more to do -- it seems that at this point what you need is to do as much research as possible regarding biochemical constraints, tertiary contacts, and possible additional templates. If there is simply not enough information to constrain a certain part of a model, you may wish to simply excise that region from your model, and explain in your paper why you did so.
Sam
However it's hard for me to properly inspect the structure since it seems to have been generated with a different program -- the different atom count means I can't render it based on my prior clash-free structures. Please provide the MMB output in the future.
forceMultiplier is just a multiplying factor for the strength of the base-pairing forces. So if making it smaller improves the structures in your opinion, then the baseInteraction's are themselves suspect.
Don't know what more to do -- it seems that at this point what you need is to do as much research as possible regarding biochemical constraints, tertiary contacts, and possible additional templates. If there is simply not enough information to constrain a certain part of a model, you may wish to simply excise that region from your model, and explain in your paper why you did so.
Sam
- Deepak kumar
- Posts: 47
- Joined: Thu Dec 12, 2013 9:13 am
Re: parameters.csv file for RNA modeling
Thank you Sam.
I understand what you mean.
In the case of residue 30 , there is a missing bond between c4' and c5' . By just creating the bond (using pymol or chimera ) between these two atoms this residue will be repaired. Is this the way your meant by repairing the residue 30, if not please let me know what is your suggestion?
thanks.
cheers!
Deepak
I understand what you mean.
In the case of residue 30 , there is a missing bond between c4' and c5' . By just creating the bond (using pymol or chimera ) between these two atoms this residue will be repaired. Is this the way your meant by repairing the residue 30, if not please let me know what is your suggestion?
thanks.
cheers!
Deepak