Hello,
I am using MMB to modify the sequence of a double stranded RNA. My PDB file has a single chain where residues 1-19 and 20-38 are the two strands. I am using the tutorial for threading change the sequence and created my own text file as following:
# Put renumbered.pdb in renumberedf.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 60
# Initial -- "target" fragment
RNA A 1 AAGGAACCAAGGCCAAUUUUAAUUGGCCUUGGUUCCUU
# TP53 -- "threaded" fragment
RNA B 1 UAUAAUGCGCUAAUCGUAAUAUGCGCUAUACGAUCGCG
mobilizer Rigid A 1 38
contact AllHeavyAtomSterics B 1 38
#Threading forces
threading A 1 38 B 1 38
#baseInteraction B 1 Superimpose A 1 Superimpose Cis
#baseInteraction B 2 Superimpose A 2 Superimpose Cis
#baseInteraction B 3 Superimpose A 3 Superimpose Cis
#baseInteraction B 4 Superimpose A 4 Superimpose Cis
#baseInteraction B 5 Superimpose A 5 Superimpose Cis
#baseInteraction B 6 Superimpose A 6 Superimpose Cis
... so on until 38
It works great for the replacement of the bases but it lost the double helix information. Could you provide me the code to be added to the text file in order to keep the double helix in the threated file?? thanks a lot!
Martina
Threading a double stranded RNA
-
Samuel Flores
- Posts: 188
- Joined: Mon Apr 30, 2007 1:06 pm
Re: Threading a double stranded RNA
Ciao Martina,
Firstly, I would strongly encourage you to use MMB 17.2, the latest release. I see you are using Windows, which would explain why you went with an old release. Do you have access to a mac or linux machine?
It could be that the "mobilizer Rigid" command is not working properly. Hard for me to debug for this old release since I don't have a windows install at the moment.
Can you provide me with a PDB file for the structured RNA, I think that is chain A? I can take a look and see if I can do it on the latest release at least.
I do notice that chain B does not seem to have the sequence one would expect in a hairpin, but chain A does. Can you explain?
Sam
Firstly, I would strongly encourage you to use MMB 17.2, the latest release. I see you are using Windows, which would explain why you went with an old release. Do you have access to a mac or linux machine?
It could be that the "mobilizer Rigid" command is not working properly. Hard for me to debug for this old release since I don't have a windows install at the moment.
Can you provide me with a PDB file for the structured RNA, I think that is chain A? I can take a look and see if I can do it on the latest release at least.
I do notice that chain B does not seem to have the sequence one would expect in a hairpin, but chain A does. Can you explain?
Sam
-
Martina Tuttolomondo
- Posts: 3
- Joined: Mon Dec 18, 2017 8:41 am
Re: Threading a double stranded RNA
Hi Samuel,
Thank you for the fast reply! First of all I pasted the wrong file with wrong sequences. Sorry! The right one is as follows:
# Put renumbered.pdb in renumberedf.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 60
# Initial -- "target" fragment
RNA A 1 AGACAGCAUUAUGCUGUCUAGACAGCAUUAUGCUGUCU
# TP53 -- "threaded" fragment
RNA B 1 UUAGGUACUAAGGUUCACCGGUGAACCUUAGUACCUAA
mobilizer Rigid A 1 38
contact AllHeavyAtomSterics B 1 38
#Threading forces
threading A 1 38 B 1 38
#baseInteraction B 1 Superimpose A 1 Superimpose Cis
#baseInteraction B 2 Superimpose A 2 Superimpose Cis
#baseInteraction B 3 Superimpose A 3 Superimpose Cis
#baseInteraction B 4 Superimpose A 4 Superimpose Cis
and so on until 38...
Unfortunately, I don't have much familiarity with Linux and this is why I found the old Windows version of your software. My pdb file is attached to this post as txt format because it didn't attach the pdb format. It would be great if you could help me!
Best regards,
Martina
Thank you for the fast reply! First of all I pasted the wrong file with wrong sequences. Sorry! The right one is as follows:
# Put renumbered.pdb in renumberedf.pdb
firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 60
# Initial -- "target" fragment
RNA A 1 AGACAGCAUUAUGCUGUCUAGACAGCAUUAUGCUGUCU
# TP53 -- "threaded" fragment
RNA B 1 UUAGGUACUAAGGUUCACCGGUGAACCUUAGUACCUAA
mobilizer Rigid A 1 38
contact AllHeavyAtomSterics B 1 38
#Threading forces
threading A 1 38 B 1 38
#baseInteraction B 1 Superimpose A 1 Superimpose Cis
#baseInteraction B 2 Superimpose A 2 Superimpose Cis
#baseInteraction B 3 Superimpose A 3 Superimpose Cis
#baseInteraction B 4 Superimpose A 4 Superimpose Cis
and so on until 38...
Unfortunately, I don't have much familiarity with Linux and this is why I found the old Windows version of your software. My pdb file is attached to this post as txt format because it didn't attach the pdb format. It would be great if you could help me!
Best regards,
Martina
- Attachments
-
- renumbered.txt
- (64.08 KiB) Downloaded 10 times
-
Samuel Flores
- Posts: 188
- Joined: Mon Apr 30, 2007 1:06 pm
Re: Threading a double stranded RNA
Very well.
here is the commands.dat you would use:
firstStage 2
lastStage 2
# Initial -- "template" fragment
loadSequencesFromPdb renumbered.txt
# TP53 -- "target" fragment
RNA B 1 UUAGGUACUAAGGUUCACCGGUGAACCUUAGUACCUAA
# worry about steric clashes only in the loop. Elsewhere, the coordinates are basically copied from the template:
contact AllHeavyAtomSterics B 17 22
mobilizer Rigid A
alignmentForces noGap
alignmentForces forceConstant 300.0
alignmentForces A 1 38 B 1 38
nucleicAcidDuplex B 1 17 B 38 22
Again, this would work in version 2.17.2.
However I did this for you. I attach the coordinates.
Are you a PHD student? There will probably be an MMB workshop this summer or even spring here in Stockholm, if you wish to join.
Sam
here is the commands.dat you would use:
firstStage 2
lastStage 2
# Initial -- "template" fragment
loadSequencesFromPdb renumbered.txt
# TP53 -- "target" fragment
RNA B 1 UUAGGUACUAAGGUUCACCGGUGAACCUUAGUACCUAA
# worry about steric clashes only in the loop. Elsewhere, the coordinates are basically copied from the template:
contact AllHeavyAtomSterics B 17 22
mobilizer Rigid A
alignmentForces noGap
alignmentForces forceConstant 300.0
alignmentForces A 1 38 B 1 38
nucleicAcidDuplex B 1 17 B 38 22
Again, this would work in version 2.17.2.
However I did this for you. I attach the coordinates.
Are you a PHD student? There will probably be an MMB workshop this summer or even spring here in Stockholm, if you wish to join.
Sam
- Attachments
-
- temp.txt
- (94.19 KiB) Downloaded 12 times
-
Martina Tuttolomondo
- Posts: 3
- Joined: Mon Dec 18, 2017 8:41 am
Re: Threading a double stranded RNA
Hi Samuel,
thank you very much! I have got my PhD one month ago. Now I am a Postdoc. I work on siRNA-cell penetrating peptides complexes. I published a paper during my PhD and now I completed the experimental part for another manuscript and I would like to include some models of my complexes before publishing. I will thank you in the paper and citing. Yes I am interested in the workshop because I am a new user and I plan to learn the newer version of the Linux software. Is there a mailing list where I can get updated about the exact workshop date? Thank you.
Best regards,
Martina
thank you very much! I have got my PhD one month ago. Now I am a Postdoc. I work on siRNA-cell penetrating peptides complexes. I published a paper during my PhD and now I completed the experimental part for another manuscript and I would like to include some models of my complexes before publishing. I will thank you in the paper and citing. Yes I am interested in the workshop because I am a new user and I plan to learn the newer version of the Linux software. Is there a mailing list where I can get updated about the exact workshop date? Thank you.
Best regards,
Martina