parameters.csv file for RNA modeling

[Samuel Flores]

Hi Deepak,

The only thing missing from this command file is :

mobilizer Rigid B

.. otherwise your template chain melts.

But I think you understand the threading procedure now.

The problem is that as you point out the threading is unsatisfactory. This is mostly because not all of the model has clear correspondence to the template. The non-threaded residues in chain A are adopting random configurations. Also, the long linkers between threaded regions are sometimes apparently geometrically incompatible with the template. All of this I think you already appreciate quite well.

Now that you have mastered this I think we can start to explore your original idea, of repairing your threaded structure and flexibly aligning it to the template. Alternatively, we could try to finish up this threading by adding base pairing information, as we did in my paper with Yaqi Wan, but that might be harder.

What is your position at IIS? Are you a PhD student? Who is your advisor? We could perhaps discuss doing this collaboratively if you are interested, as there is no one method that does everything you need.

Sam





Samuel

[Deepak kumar]

The run has finished based on this command file below and the results are :

I have run till stage 5


firstStage 2
lastStage 5
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False

# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG

# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG

#constrainToGround A 1
#constrainToGround B 1
#constraint A 1 Weld A 229
#constraint B 1 Weld B 247
mobilizer Rigid B
#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229
contact AllHeavyAtomSterics A 1 229
leontisWesthofInFileName parameters.csv
temperature 40.0
#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300

#mobilizer Rigid A 33 102
#mobilizer Rigid A 139 229

baseInteraction A 32 Superimpose B 3 Superimpose Cis
baseInteraction A 33 Superimpose B 4 Superimpose Cis
baseInteraction A 34 Superimpose B 5 Superimpose Cis
baseInteraction A 35 Superimpose B 6 Superimpose Cis
baseInteraction A 36 Superimpose B 7 Superimpose Cis
baseInteraction A 37 Superimpose B 8 Superimpose Cis
baseInteraction A 38 Superimpose B 9 Superimpose Cis
baseInteraction A 39 Superimpose B 10 Superimpose Cis
baseInteraction A 40 Superimpose B 11 Superimpose Cis
baseInteraction A 41 Superimpose B 12 Superimpose Cis
baseInteraction A 42 Superimpose B 13 Superimpose Cis
baseInteraction A 43 Superimpose B 14 Superimpose Cis
baseInteraction A 44 Superimpose B 15 Superimpose Cis
baseInteraction A 45 Superimpose B 16 Superimpose Cis
baseInteraction A 46 Superimpose B 17 Superimpose Cis
baseInteraction A 47 Superimpose B 18 Superimpose Cis
baseInteraction A 48 Superimpose B 19 Superimpose Cis
baseInteraction A 53 Superimpose B 106 Superimpose Cis
baseInteraction A 54 Superimpose B 107 Superimpose Cis
baseInteraction A 55 Superimpose B 108 Superimpose Cis
baseInteraction A 56 Superimpose B 109 Superimpose Cis
baseInteraction A 57 Superimpose B 110 Superimpose Cis
baseInteraction A 58 Superimpose B 111 Superimpose Cis
baseInteraction A 59 Superimpose B 112 Superimpose Cis
baseInteraction A 60 Superimpose B 113 Superimpose Cis
baseInteraction A 61 Superimpose B 114 Superimpose Cis
baseInteraction A 62 Superimpose B 115 Superimpose Cis
baseInteraction A 63 Superimpose B 116 Superimpose Cis
baseInteraction A 64 Superimpose B 117 Superimpose Cis
baseInteraction A 65 Superimpose B 118 Superimpose Cis
baseInteraction A 66 Superimpose B 119 Superimpose Cis
baseInteraction A 67 Superimpose B 120 Superimpose Cis
baseInteraction A 68 Superimpose B 121 Superimpose Cis
baseInteraction A 69 Superimpose B 122 Superimpose Cis
baseInteraction A 70 Superimpose B 123 Superimpose Cis
baseInteraction A 71 Superimpose B 124 Superimpose Cis
baseInteraction A 72 Superimpose B 125 Superimpose Cis
baseInteraction A 73 Superimpose B 126 Superimpose Cis
baseInteraction A 74 Superimpose B 127 Superimpose Cis
baseInteraction A 75 Superimpose B 128 Superimpose Cis
baseInteraction A 76 Superimpose B 129 Superimpose Cis
baseInteraction A 77 Superimpose B 130 Superimpose Cis
baseInteraction A 78 Superimpose B 131 Superimpose Cis
baseInteraction A 83 Superimpose B 152 Superimpose Cis
baseInteraction A 84 Superimpose B 153 Superimpose Cis
baseInteraction A 85 Superimpose B 154 Superimpose Cis
baseInteraction A 86 Superimpose B 155 Superimpose Cis
baseInteraction A 87 Superimpose B 156 Superimpose Cis
baseInteraction A 88 Superimpose B 157 Superimpose Cis
baseInteraction A 89 Superimpose B 158 Superimpose Cis
baseInteraction A 90 Superimpose B 159 Superimpose Cis
baseInteraction A 91 Superimpose B 160 Superimpose Cis
baseInteraction A 92 Superimpose B 161 Superimpose Cis
baseInteraction A 93 Superimpose B 162 Superimpose Cis
baseInteraction A 94 Superimpose B 163 Superimpose Cis
baseInteraction A 95 Superimpose B 164 Superimpose Cis
baseInteraction A 96 Superimpose B 165 Superimpose Cis
baseInteraction A 97 Superimpose B 166 Superimpose Cis
baseInteraction A 98 Superimpose B 167 Superimpose Cis
baseInteraction A 99 Superimpose B 168 Superimpose Cis
baseInteraction A 100 Superimpose B 169 Superimpose Cis
baseInteraction A 101 Superimpose B 170 Superimpose Cis
baseInteraction A 102 Superimpose B 171 Superimpose Cis
baseInteraction A 139 Superimpose B 176 Superimpose Cis
baseInteraction A 140 Superimpose B 177 Superimpose Cis
baseInteraction A 141 Superimpose B 178 Superimpose Cis
baseInteraction A 142 Superimpose B 179 Superimpose Cis
baseInteraction A 143 Superimpose B 180 Superimpose Cis
baseInteraction A 144 Superimpose B 181 Superimpose Cis
baseInteraction A 145 Superimpose B 182 Superimpose Cis
baseInteraction A 146 Superimpose B 183 Superimpose Cis
baseInteraction A 147 Superimpose B 184 Superimpose Cis
baseInteraction A 148 Superimpose B 185 Superimpose Cis
baseInteraction A 149 Superimpose B 186 Superimpose Cis
baseInteraction A 150 Superimpose B 187 Superimpose Cis
baseInteraction A 151 Superimpose B 188 Superimpose Cis
baseInteraction A 152 Superimpose B 189 Superimpose Cis
baseInteraction A 153 Superimpose B 190 Superimpose Cis
baseInteraction A 154 Superimpose B 191 Superimpose Cis
baseInteraction A 155 Superimpose B 192 Superimpose Cis
baseInteraction A 156 Superimpose B 193 Superimpose Cis
baseInteraction A 157 Superimpose B 194 Superimpose Cis
baseInteraction A 158 Superimpose B 195 Superimpose Cis
baseInteraction A 159 Superimpose B 196 Superimpose Cis
baseInteraction A 160 Superimpose B 197 Superimpose Cis
baseInteraction A 165 Superimpose B 211 Superimpose Cis
baseInteraction A 166 Superimpose B 212 Superimpose Cis
baseInteraction A 167 Superimpose B 213 Superimpose Cis
baseInteraction A 168 Superimpose B 214 Superimpose Cis
baseInteraction A 169 Superimpose B 215 Superimpose Cis
baseInteraction A 170 Superimpose B 216 Superimpose Cis
baseInteraction A 171 Superimpose B 217 Superimpose Cis
baseInteraction A 172 Superimpose B 218 Superimpose Cis
baseInteraction A 173 Superimpose B 219 Superimpose Cis
baseInteraction A 174 Superimpose B 220 Superimpose Cis
baseInteraction A 175 Superimpose B 221 Superimpose Cis
baseInteraction A 176 Superimpose B 222 Superimpose Cis
baseInteraction A 177 Superimpose B 223 Superimpose Cis
baseInteraction A 178 Superimpose B 224 Superimpose Cis
baseInteraction A 179 Superimpose B 225 Superimpose Cis
baseInteraction A 180 Superimpose B 226 Superimpose Cis
baseInteraction A 181 Superimpose B 227 Superimpose Cis
baseInteraction A 182 Superimpose B 228 Superimpose Cis
baseInteraction A 183 Superimpose B 229 Superimpose Cis
baseInteraction A 184 Superimpose B 230 Superimpose Cis
baseInteraction A 185 Superimpose B 231 Superimpose Cis
baseInteraction A 186 Superimpose B 232 Superimpose Cis
baseInteraction A 187 Superimpose B 233 Superimpose Cis
baseInteraction A 220 Superimpose B 238 Superimpose Cis
baseInteraction A 221 Superimpose B 239 Superimpose Cis
baseInteraction A 222 Superimpose B 240 Superimpose Cis
baseInteraction A 223 Superimpose B 241 Superimpose Cis
baseInteraction A 224 Superimpose B 242 Superimpose Cis
baseInteraction A 225 Superimpose B 243 Superimpose Cis
baseInteraction A 226 Superimpose B 244 Superimpose Cis
baseInteraction A 227 Superimpose B 245 Superimpose Cis
baseInteraction A 228 Superimpose B 246 Superimpose Cis
baseInteraction A 229 Superimpose B 247 Superimpose Cis

The results of this run is :

last.2.pdb:
https://www.dropbox.com/s/e2zqqq0ecrelzxu/last.2.pdb

trajectory.5.pdb:
https://www.dropbox.com/s/sq34jxqwvluas ... tory.5.pdb

last.5.pdb:
https://www.dropbox.com/s/09lt4t3mabgg7ri/last.5.pdb

template.pdb
https://www.dropbox.com/s/vqn39bleue20fdq/template.pdb

model-native.pdb
https://www.dropbox.com/s/t1sbi1rx3qfm0 ... native.pdb

As we see that the insertions/deletions have changed conformations but not yet close to native.

Could you give ur suggestions/guide to improve the repairing of threaded regions and flexibly align it to the template and remodel the not well conformed insertions and deletions (1-32 and 103-138 iin chain A model).?

In next run, I tried using the folded chain A model along with chain B template ( in last.1.pdb ) in order to rigidify all the regions except for 1-32 and 103-138 in model chain A but i get this error :

the last.1.pdb file i get error is this : in this chain A model is minimized.
https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb

/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 227/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 228/N9. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 228/C5. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 228/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 228/C6. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:518done with myBiopolymer.matchDefaultAtomChirality
/bubo/home/h23/alext/molmodel/src/CompoundAtom.h:413 No solution found .. v1 v2 cosTheta = -2.02917, -2.02917, -0.835739. Consider a larger planarity threshold.
/bubo/home/h23/alext/molmodel/src/CompoundAtom.h:414 1.0 - (v1*v1 + v2*v2 + 2.0*v1*v2*cosTheta) = -0.352698

If you see any error in the last.1.pdb file above please let me know. Also, if you could tell me how you find out the bad bond geometries manually ( this is new to me )?

Thank you so much for the proposal. At present I am trying to overcome this problem and once a solution to it is found then I can decide of what to do with the project and its collaboration.

thanks.
cheers!
Deepak

[Samuel Flores]

Hi Deepak,

The way to locate the geometric problems is the following.

1. start over in a new directory.
2. Create a last.1.pdb which contains both chain A and B. Chain A will be the one you earlier generated by threading. The one with the bond geometry problems.
3. Create a shortened version of chain A. For instance RNA A 1 GAGCCUUUAUACAGU . See the snippet below.
4. Run MMB. Don't worry about the results, the only point is to see that the run is able to start.
5. If MMB runs, the thus-shortened chain A does NOT contain any problem geometries. Stop the job and make the RNA chain A longer, e.g. RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUC .
6. Repeat 3,4, and 5 until you find the first residue that causes a problem. Then correct the bond geometry by editing last.1.pdb and changing coordinates of the offending atom until MMB can run. I have already sent you the location of the first problematic residue, the atom name, and means to correct, in an earlier posting.
7. Repeat steps 3-6 until you find the second problematic residue, then the third and so on.

Sam

firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 160
removeRigidBodyMomentum False

# -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG

# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGU

[Deepak kumar]

Thanks .

I am following your suggestion and I found this residue in chain A to have problem :

ATOM 860 P A A 28 -17.883 -34.704 -48.413 1.00 30.00 P
ATOM 861 C5' A A 28 -17.245 -36.265 -46.371 1.00 30.00 C
ATOM 862 O5' A A 28 -18.198 -35.893 -47.372 1.00 30.00 O
ATOM 863 C4' A A 28 -17.767 -37.454 -45.519 1.00 30.00 C
ATOM 864 O4' A A 28 -19.091 -37.200 -44.955 1.00 30.00 O
ATOM 865 C3' A A 28 -17.902 -38.716 -46.358 1.00 30.00 C
ATOM 866 O3' A A 28 -16.948 -39.744 -46.223 1.00 30.00 O
ATOM 867 C2' A A 28 -19.178 -39.377 -45.843 1.00 30.00 C
ATOM 868 O2' A A 28 -19.051 -40.409 -44.897 1.00 30.00 O
ATOM 869 C1' A A 28 -19.899 -38.389 -44.961 1.00 30.00 C
ATOM 870 N1 A A 28 -24.518 -40.545 -46.822 1.00 30.00 N
ATOM 871 C2 A A 28 -23.773 -40.890 -45.787 1.00 30.00 C
ATOM 872 N3 A A 28 -22.786 -40.266 -45.146 1.00 30.00 N
ATOM 873 C4 A A 28 -22.263 -39.209 -45.861 1.00 30.00 C
ATOM 874 C5 A A 28 -22.845 -38.856 -47.035 1.00 30.00 C
ATOM 875 C6 A A 28 -24.066 -39.477 -47.458 1.00 30.00 C
ATOM 876 N6 A A 28 -24.919 -39.181 -48.450 1.00 30.00 N
ATOM 877 N7 A A 28 -21.982 -38.001 -47.600 1.00 30.00 N
ATOM 878 C8 A A 28 -21.044 -37.636 -46.832 1.00 30.00 C
ATOM 879 N9 A A 28 -21.172 -38.291 -45.669 1.00 30.00 N
ATOM 880 OP1 A A 28 -16.556 -34.815 -48.983 1.00 30.00 O
ATOM 881 OP2 A A 28 -19.088 -34.536 -49.279 1.00 30.00 O
ATOM 882 HO2' A A 28 -18.114 -40.657 -45.057 1.00 0.00 H
ATOM 883 H2 A A 28 -24.109 -41.813 -45.362 1.00 0.00 H
ATOM 884 H8 A A 28 -20.226 -36.970 -47.122 1.00 0.00 H
ATOM 885 H1' A A 28 -20.010 -38.756 -43.951 1.00 0.00 H
ATOM 886 H2' A A 28 -19.713 -39.705 -46.744 1.00 0.00 H
ATOM 887 H3' A A 28 -18.028 -38.384 -47.393 1.00 0.00 H
ATOM 888 H4' A A 28 -17.022 -37.670 -44.749 1.00 0.00 H
ATOM 889 H5' A A 28 -17.050 -35.410 -45.723 1.00 0.00 H
ATOM 890 H61 A A 28 -24.971 -38.181 -48.603 1.00 0.00 H
ATOM 891 H62 A A 28 -24.432 -39.468 -49.301 1.00 0.00 H
ATOM 892 H5'' A A 28 -16.281 -36.521 -46.830 1.00 0.00 H

but since am new to this, I dont see what is the problem? Can you help me know where is the problem?

Thanks
cheers!

[Samuel Flores]

it's not residue 28, It's residue 29 that causes a problem. If you include residues 1-28, everything runs fine.

On residue 29, the C5' atom is a bit too close to being coplanar with the ribose ring. I think that's the problem. If you shift it by -1 in the Z direction, it seems to be fine.

Try looking for the next problem residue now.

Sam

[Samuel Flores]

Also, please post your last.1.pdb next time if you want me to take a look at it.

Sam

[Deepak kumar]

Thanks again.

I understand the problem with the geometry.

I have solved the geometric problems till 144 but in this 145th residue of chain A my modifications dont work.

I looked at it in pymol and the residue seems to be not bonded with flanking residues too.

the last.1.pdb file is :

https://www.dropbox.com/s/drt9q3f4njei3a2/last.1.pdb

Can you please have alook and give ur suggestions?

Thanks
cheers!

[Samuel Flores]

Hi Deepak,

Turns out fixing residue 145 is a bit difficult. So I made a special early release of MMB 2.14 for you. Please fetch it here:

http://xray.bmc.uu.se/flores/temp/Insta ... inux64.tgz

Please test it (e.g. with commands.hairpin-short.dat) and confirm that it all works. Make sure you update your LD_LIBRARY_PATH if needed.

The reason you will find this release useful, is because now you will be able to simply delete residue 145 (and any other offending residues, for that matter). MMB will then invent atom positions to replace the missing atoms. The atoms which you do provide, will still be matched perfectly. There will probably be some unnatural bond geometries at the boundaries of such gaps, but we'll deal with them in a bit -- they won't be too difficult.

Once you've done that, please share your last.1.pdb and commands.dat.

Sam

PS: For anyone else reading this -- this is not the official release. I haven't proofread the updated documentation, for instance. And since we've been pretty active recently there may be a couple of new bugs that crept in. Caveat emptor.

PPS: Deepak -- I think this will work -- and if so you owe me a beer!

[Deepak kumar]

Thank you so much Sam.

I will install this new package and let you know about the results.

If I understood right then in this new release MMB , I will simply delete residues causing problem in the chain A model and in "command.dat" file keep the whole sequence of chain A model along with this residue "A" (145th residue in chain A) so MMB will generate atoms for this deleted residue keeping the track of flanking residues.

And yes sure..I owe you a beer! it's on me

Thanks
cheers!

[Samuel Flores]

Yes, you understood correctly. Modify last.1.pdb, but not your command file. If you have any problem let me know. It might be necessary to issue "matchPerfect" which does some additional coordinate matching optimizations, but I doubt it. At any rate first let's make sure it works for you.

I think there's a need for a new threading method. Maybe something that starts out with an automated method like the one you used, then uses MMB to repair the indels.