parameters.csv file for RNA modeling

[Deepak kumar]

Hi, I am trying to model some regions of an already modelled RNa molecule. I went through the tutorial and I got some idea about the "mobilizer" and how to make a region "rigid". I have the modeled RNA. I am attaching the modeled RNA and the template structure. I have problems in understanding the "parameters.csv" file and to make it compatible for my model.

For example: In the model file , I want to fix the region from residue 32 to 48 and let the region from 1 to 31 be free.

Could you please help me in this matter?

Model pdb file :

https://www.dropbox.com/s/938m0zgorzess ... led-target

Template pdb file :

https://www.dropbox.com/s/0gcwimio3gnl3p6/template

Thanks.
Deepak

[Samuel Flores]

Hi Deepak,

parameters.csv contains the translation-rotation matrices for the base pairing force field, and other parameters. Most users will not need to modify this file. If I understand you correctly, what you want to do is easy and should all be done in the command file.

Say your model is chain A. I think you should just do:

mobilizer Rigid A 32 48

if this is not enough, please include your command file.

There is an example in the tutorial on threading, you should follow that and see if it answers your questions.

Sam

[Deepak kumar]

Thank you for your reply. The command line I use is :

RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG

removeRigidBodyMomentum False
constrainToGround A 1
mobilizer Rigid A 32 48
mobilizer Rigid A 53 78
mobilizer Rigid A 83 102
mobilizer Rigid A 139 160
mobilizer Rigid A 165 187
mobilizer Rigid A 220 229
constraint A 1 Weld A 229
constraintTolerance .001
contact SelectedAtoms A FirstResidue LastResidue

numReportingIntervals 200
reportingInterval 2.0
firstStage 2
lastStage 2
leontisWesthofInFileName parameters.csv

temperature 10.0

When I run the command ./MMB.2_13.Linux64 -c command-1yoq-model.dat

I get this as std output :

deepak@deepak-S5520SC:/media/Data_soft/Softwares/rnabuilder/Installer.2_13.Linux64$ ./MMB.2_13.Linux64 -c command-model.dat

Usage: MMB [options]

.. your MMB executable name will vary depending on platform and release.
Options:
-help Display this information
-c contactsFile Set name of contacts file
Commercial use of this software requires payment of usage fees

Last compiled on Aug 27 2013 at 10:45:45

MMB units are nm, kJ/mol, ps, and daltons (g/mol). In MMB 2.10 and earlier, we took some lengths and ground locations in Å (atomSpring, springToGround, atomTether, applyContactsWithin, applyMobilizersWithin, etc.). As of MMB 2.11 all such lengths and locations are in nm. Please update your older scripts if you plan to reuse them in MMB 2.11 and later.


/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:65 Current working directory: /media/Data_soft/Softwares/rnabuilder/Installer.2_13.Linux64/
output directory = ./
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:133 About to read command-1yoq-model.dat to set firstStage and lastStage
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:19 Just cleared residueStretchVector .. this now contains 0 contacts
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:136 lastStage = 2
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:137 firstStage = 2
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:19 Just cleared residueStretchVector .. this now contains 0 contacts
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:19 Just cleared residueStretchVector .. this now contains 0 contacts
Now checking for existence of ./parameters.csv
done initializing myLeontisWesthofBondMatrix
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2901 : Just set variable @CURRENTSTAGE to 2
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:334
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:344
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:364
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:977 Just loaded residueIDVector with defaults starting with 1
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9791/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9792/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9793/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9794/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9795/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9796/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9797/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9798/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:9799/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97910/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97911/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97912/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97913/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97914/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97915/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97916/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97917/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97918/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97919/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97920/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97921/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97922/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97923/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97924/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97925/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97926/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97927/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97928/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97929/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97930/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97931/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97932/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97933/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97934/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97935/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97936/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97937/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97938/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97939/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97940/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97941/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97942/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97943/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97944/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97945/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97946/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97947/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97948/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97949/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97950/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97951/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97952/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97953/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97954/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97955/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97956/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97957/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97958/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97959/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97960/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97961/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97962/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97963/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97964/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97965/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97966/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97967/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97968/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97969/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97970/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97971/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97972/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97973/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97974/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97975/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97976/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97977/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97978/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97979/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97980/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97981/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97982/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97983/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97984/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97985/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97986/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97987/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97988/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97989/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97990/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97991/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97992/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97993/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97994/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97995/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97996/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97997/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97998/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:97999/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979100/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979101/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979102/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979103/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979104/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979105/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979106/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979107/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979108/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979109/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979110/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979111/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979112/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979113/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979114/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979115/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979116/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979117/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979118/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979119/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979120/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979121/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979122/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979123/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979124/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979125/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979126/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979127/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979128/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979129/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979130/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979131/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979132/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979133/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979134/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979135/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979136/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979137/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979138/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979139/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979140/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979141/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979142/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979143/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979144/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979145/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979146/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979147/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979148/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979149/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979150/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979151/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979152/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979153/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979154/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979155/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979156/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979157/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979158/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979159/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979160/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979161/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979162/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979163/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979164/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979165/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979166/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979167/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979168/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979169/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979170/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979171/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979172/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979173/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979174/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979175/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979176/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979177/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979178/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979179/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979180/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979181/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979182/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979183/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979184/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979185/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979186/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979187/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979188/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979189/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979190/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979191/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979192/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979193/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979194/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979195/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979196/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979197/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979198/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979199/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979200/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979201/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979202/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979203/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979204/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979205/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979206/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979207/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979208/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979209/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979210/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979211/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979212/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979213/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979214/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979215/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979216/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979217/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979218/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979219/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979220/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979221/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979222/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979223/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979224/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979225/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979226/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979227/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979228/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:979229/bubo/home/h23/alext/MMB_src/include/Utils.h:189
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line:
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 removeRigidBodyMomentum False
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: removeRigidBodyMomentum False
FALSE
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 constrainToGround A 1
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: constrainToGround A 1
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1467 : Syntax: constrainToGround <chain> <ResidueID>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1489 : Looks like you're welding the first residue to ground. Please consider using the rootMobilizer command -- it's more accurate and much cheaper.
/bubo/home/h23/alext/MMB_src/src/ConstraintContainer.cpp:70 About to add constraintToGround for chain ID, ResidueID, and atomName: A, 1, C4*
/bubo/home/h23/alext/MMB_src/src/ConstraintContainer.cpp:64 About to add constraint class :
/bubo/home/h23/alext/MMB_src/include/Utils.h:464 : Chain ID : A Residue ID: 1 atom name : C4* : Chain ID2 : Residue ID2: 0 atom name2 : to Ground: 1
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 32 48
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 32 48
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 32
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 48
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 53 78
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 53 78
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 53
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 78
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 83 102
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 83 102
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 83
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 102
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 139 160
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 139 160
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 139
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 160
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 165 187
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 165 187
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 165
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 187
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 mobilizer Rigid A 220 229
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: mobilizer Rigid A 220 229
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1290 Syntax: mobilizer <Bond Mobility> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1291 Or: mobilizer <Bond Mobility> <chain> .. to set all residues in <chain> to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1292 Or: mobilizer <Bond Mobility> .. to set all residues in all chains to <Bond Mobility>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1293 Where Bond Mobility may be RNA, DNA, or Protein
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1312first residue ID: 220
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1313second residue ID: 229
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 constraint A 1 Weld A 229
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: constraint A 1 Weld A 229
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1399 : Syntax: constraint <chain 1> <residue ID 1> Weld Ground
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1400 : Or: constraint <chain 1> <residue ID 1> Weld <chain 2> <residue ID 2>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1401 : Or: constraint <chain 1> <residue ID 1> <atom name 1> Weld <chain 2> <residue ID 2> <atom name 2>
/bubo/home/h23/alext/MMB_src/src/ConstraintContainer.cpp:64 About to add constraint class :
/bubo/home/h23/alext/MMB_src/include/Utils.h:464 : Chain ID : A Residue ID: 1 atom name : C4* : Chain ID2 : A Residue ID2: 229 atom name2 : C4* to Ground: 0
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 constraintTolerance .001
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: constraintTolerance .001
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:255 We appear to be in a leaf of the recursion tree for myAtoF. Parsed >.001< as : 0.001
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 contact SelectedAtoms A FirstResidue LastResidue
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: contact SelectedAtoms A FirstResidue LastResidue
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1596 Current syntax of the "contact" command is: contact <contact scheme> <chain> <start residue> <end residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1597 Or: contact <contact scheme> <chain> <residue>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1598 Or: contact <contact scheme> <chain>
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:2426 You have requested the first residue of chain A, which is : 1
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:2430 You have requested the last residue of chain A, which is : 229
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:141 Contact scheme = SelectedAtoms chain= A from residue 1 to 229
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:225 Just added a contact to the residue stretch vector. Now have 1 contacts
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:230 from residue 1 to 229
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:231 Contact 0 scheme = SelectedAtoms/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:141 Contact scheme = SelectedAtoms chain= A from residue 1 to 229
/bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:146 Contact 0 /bubo/home/h23/alext/MMB_src/src/ContactContainer.cpp:141 Contact scheme = SelectedAtoms chain= A from residue 1 to 229
/bubo/home/h23/alext/MMB_src/include/Utils.h:189
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line:
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 numReportingIntervals 200
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: numReportingIntervals 200
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 reportingInterval 2.0
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: reportingInterval 2.0
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:255 We appear to be in a leaf of the recursion tree for myAtoF. Parsed >2.0< as : 2
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 firstStage 2
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: firstStage 2
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 lastStage 2
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: lastStage 2
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 leontisWesthofInFileName parameters.csv
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: leontisWesthofInFileName parameters.csv
/bubo/home/h23/alext/MMB_src/include/Utils.h:189
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line:
/bubo/home/h23/alext/MMB_src/include/Utils.h:189 temperature 10.0
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line: temperature 10.0
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:1933: syntax: temperature <temperature>
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:255 We appear to be in a leaf of the recursion tree for myAtoF. Parsed >10.0< as : 10
/bubo/home/h23/alext/MMB_src/include/Utils.h:189
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line:
/bubo/home/h23/alext/MMB_src/include/Utils.h:189
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2950 read line:
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2967 After reading command file, here is the list of atom springs:
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:2969 Done printing atom springs.
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:3047 In ParameterReader::postInitialize, printing out density stretches:
/bubo/home/h23/alext/MMB_src/src/DensityContainer.cpp:64 About to print all 0 density stretches
.1 - integratorAccuracy 0.0999
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:3061 RNABuilder will not reorder base pairs (prioritize 1) for multi-chain jobs. If you have multiple chains make sure to set prioritize 0.
/bubo/home/h23/alext/MMB_src/src/BasePairContainer.cpp:addHelicalStacking:321 Running addHelicalStacking
/bubo/home/h23/alext/MMB_src/src/BasePairContainer.cpp:addHelicalStacking:327 Running addHelicalStacking for chain A
/bubo/home/h23/alext/MMB_src/src/BasePairContainer.cpp:addHelicalStacking:369 Done adding helical stackings. So far we have 0 baseInteraction's. They are:
/bubo/home/h23/alext/MMB_src/src/BasePairContainer.cpp:375 Printing all base pairs:
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:470 : removeNonPriorityBasePairs] At this stage, temperature = 10
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:169 myParameterReader.basePairContainer.numBasePairs()0
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:171 myParameterReader.basePairContainer.numBasePairs()0
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:175 myParameterReader.firstStage=2
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:206 about to make sure we aren't trying to read from BOTH .pdb and QVector files, but exactly one.
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:209
/bubo/home/h23/alext/MMB_src/src/ParameterReader.cpp:470 : removeNonPriorityBasePairs] At this stage, temperature = 10
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:211 BASE PAIRS before removing from rigid stretches:
/bubo/home/h23/alext/MMB_src/src/BasePairContainer.cpp:375 Printing all base pairs:
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:214 1
/bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:215 stage =2
addAllAtomSterics bool 0
addAllHeavyAtomSterics bool 0
addProteinBackboneSterics bool 0
addRNABackboneSterics bool 0
addSelectedAtoms bool 0 : Add steric spheres to certain RNA atoms as specified in the RNABuilder parameter file.
applyC1pSprings bool 1
calcEnergy bool 1
constrainRigidSegments bool 0
constraintTolerance double 0.001
cutoffRadius double 0.1 (nm)
densityAtomFraction String 1
densityFileName String densityFileName-NOT-SET
densityForceConstant double 1
dutyCycle double 1 : Must lie in (0,1)
excludedVolumeRadius double 0.06 : Radius (in nm) of contact spheres to be applied in AllHeavyAtomSterics and AllAtomSterics.
excludedVolumeStiffness double 1e+07
firstStage int 2
fitDefaultTolerance double 0.3
baseInteractionScaleFactor double 10
globalAmberImproperTorsionScaleFactor double 0
globalBondBendScaleFactor double 1
globalBondStretchScaleFactor double 1
globalBondTorsionScaleFactor double 1
globalCoulombScaleFactor double 0
globalGbsaScaleFactor double 0
globalVdwScaleFactor double 0
inQVectorFileName String ./last.qVector.1.dat
initialSeparation double 20
integratorAccuracy double 0.0001
integratorStepSize int 0.001
integratorType String RungeKuttaMerson
lastStage int 2
leontisWesthofInFileName String parameters.csv
loadTinkerParameterFile bool 0
outQVectorFileName String ./last.qVector.2.dat
magnesiumIonChainId String X
magnesiumIonRadius String 25
matchHydrogenAtomLocations bool 0 : If false, do not read the hydrogen atom positions from the input pdb file. Just guess new atom locations. This is useful if the hydrogens are in bad (e.g. colinear) locations.
matchExact bool 1 If True, this matches all bond lengths, angles, and dihedrals to the 2-, 3-, and 4- neighbor atom sets. Locally the match will be nearly perfect, but over a long biopolymer error can accumulate.
matchIdealized bool 0 If True, the bond lengths and angles will be set to default (idealized) values and the torsion angles will be iteratively adjusted to match the input structure. Thus the global structure is likely to be good, but small-scale details will differ from those of the input structure. This is much more expensive than matchExact.
matchOptimize bool 0 If True, this matches all bond lengths, angles, and dihedrals to the 2-, 3-, and 4- neighbor atom sets. Locally the match will be nearly perfect, but over a long biopolymer error can accumulate.
minimize bool 0
monteCarloTemperature int 400
monteCarloTemperatureIncrement int 0.1
nastGlobalBondTorsionScaleFactor int 10
noseHooverTime double 10
numReportingIntervals int 200
outMonteCarloFileName String ./trajectory.MonteCarlo.2.pdb
outTrajectoryFileName String ./trajectory.2.pdb
planarityThreshold double 0.07
potentialType int HarmonicInverse
prioritize int 0
proteinCapping bool 0 : When true, adds terminal capping groups to protein chains.
randomizeInitialVelocities bool 0 : When true, adds a stochastic velocity to each body at the beginning of the stage.
readPreviousFrameFile bool 1
readMagnesiumPositionsFromFile bool 1
removeMomentumPeriod double 0
removeRigidBodyMomentum bool 0
reportingInterval double 2
restrainingForceConstant double 1e+06
restrainingTorqueConstant double 10000
rigidifyFormedHelices int 0
scrubberPeriod double 40
safeParameters int 1
setChiBondMobility int 0
setForceAndStericScrubber bool 0
setForceScrubber bool 0
setHelicalStacking bool 1
setRemoveBasePairsInRigidStretch bool 1
setTemperature bool 1
smallGroupInertiaMultiplier double 1
stackAllHelicalResidues bool 1
temperature bool 10
thermostatType String NoseHoover
tinkerParameterFileName String NOT-SET
useFixedStepSize bool 0
useMultithreadedComputation bool 0
useOpenMMAcceleration bool 0
vanderWallSphereRadius double 300
velocityRescalingInterval int 1
verbose int 0
vmdOutput int 0
waterDropletMake bool 0
waterInertiaMultiplier double 1
writeCoordinates bool 1
writeDoublePrecisionTrajectories bool 0
writeLastFrameFile bool 1
helixBondMobility BondMobility::Mobility3
loopBondMobility BondMobility::Mobility2
overallBondMobility BondMobility::Mobility1
chiBondMobility BondMobility::Mobility1
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:401 about to match chain "A" to file name : ./last.1.pdb
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:405
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:516about to myBiopolymer.matchDefaultAtomChirality.
WARNING: Flipping chirality of bond from atom 29/P to atom 29/OP1
WARNING: Flipping chirality of bond from atom 29/P to atom 29/OP2
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 39/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 40/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
WARNING: Flipping chirality of bond from atom 51/P to atom 51/OP1
WARNING: Flipping chirality of bond from atom 51/P to atom 51/OP2
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 75/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
WARNING: Flipping chirality of bond from atom 79/P to atom 79/OP1
WARNING: Flipping chirality of bond from atom 79/P to atom 79/OP2
WARNING: Flipping chirality of bond from atom 81/P to atom 81/OP1
WARNING: Flipping chirality of bond from atom 81/P to atom 81/OP2
WARNING: Flipping chirality of bond from atom 81/C4* to atom 81/C3*
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 92/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 94/N1. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 95/N9. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 96/N9. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
WARNING: Flipping chirality of bond from atom 103/P to atom 103/OP1
WARNING: Flipping chirality of bond from atom 103/P to atom 103/OP2
WARNING: Flipping chirality of bond from atom 137/P to atom 137/OP1
WARNING: Flipping chirality of bond from atom 137/P to atom 137/OP2
WARNING: Flipping chirality of bond from atom 161/P to atom 161/OP1
WARNING: Flipping chirality of bond from atom 161/P to atom 161/OP2
WARNING: Flipping chirality of bond from atom 163/P to atom 163/OP1
WARNING: Flipping chirality of bond from atom 163/P to atom 163/OP2
WARNING: Flipping chirality of bond from atom 163/C4* to atom 163/C3*
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 164/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
/bubo/home/h23/alext/molmodel/src/CompoundRep.h:1216 WARNING: matching out-of-plane atoms about atom 167/C4. Note that here we are using residue INDEX, not residue NUMBER. Residue indices start at 0.
WARNING: Flipping chirality of bond from atom 188/P to atom 188/OP1
WARNING: Flipping chirality of bond from atom 188/P to atom 188/OP2
WARNING: Flipping chirality of bond from atom 218/P to atom 218/OP1
WARNING: Flipping chirality of bond from atom 218/P to atom 218/OP2
/bubo/home/h23/alext/MMB_src/src/BiopolymerClass.cpp:518done with myBiopolymer.matchDefaultAtomChirality
/bubo/home/h23/alext/molmodel/src/CompoundAtom.h:413 No solution found .. v1 v2 cosTheta = -12.6477, -12.6477, -0.973646. Consider a larger planarity threshold.
/bubo/home/h23/alext/molmodel/src/CompoundAtom.h:414 1.0 - (v1*v1 + v2*v2 + 2.0*v1*v2*cosTheta) = -7.43131

and "trajectory.2.pdb" looks like this below, with no trajectories. I guess I am using some parameter in a wrong way but dont know which one:


REMARK contents of user input file command-1yoq-model.dat :

REMARK RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG
REMARK
REMARK removeRigidBodyMomentum False
REMARK constrainToGround A 1
REMARK mobilizer Rigid A 32 48
REMARK mobilizer Rigid A 53 78
REMARK mobilizer Rigid A 83 102
REMARK mobilizer Rigid A 139 160
REMARK mobilizer Rigid A 165 187
REMARK mobilizer Rigid A 220 229
REMARK constraint A 1 Weld A 229
REMARK constraintTolerance .001
REMARK contact SelectedAtoms A FirstResidue LastResidue
REMARK
REMARK numReportingIntervals 200
REMARK reportingInterval 2.0
REMARK firstStage 2
REMARK lastStage 2
REMARK leontisWesthofInFileName parameters.csv
REMARK
REMARK temperature 10.0
REMARK
REMARK

REMARK end of user input file


REMARK /bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:221 about to call myParameterReader.printAllSettings

REMARK addAllAtomSterics bool 0
REMARK addAllHeavyAtomSterics bool 0
REMARK addProteinBackboneSterics bool 0
REMARK addRNABackboneSterics bool 0
REMARK addSelectedAtoms bool 0 : Add steric spheres to certain RNA atoms as specified in the RNABuilder parameter file.
REMARK applyC1pSprings bool 1
REMARK calcEnergy bool 1
REMARK constrainRigidSegments bool 0
REMARK constraintTolerance double 0.001
REMARK cutoffRadius double 0.1 (nm)
REMARK densityAtomFraction String 1
REMARK densityFileName String densityFileName-NOT-SET
REMARK densityForceConstant double 1
REMARK dutyCycle double 1 : Must lie in (0,1)
REMARK excludedVolumeRadius double 0.06 : Radius (in nm) of contact spheres to be applied in AllHeavyAtomSterics and AllAtomSterics.
REMARK excludedVolumeStiffness double 1e+07
REMARK firstStage int 2
REMARK fitDefaultTolerance double 0.3
REMARK baseInteractionScaleFactor double 10
REMARK globalAmberImproperTorsionScaleFactor double 0
REMARK globalBondBendScaleFactor double 1
REMARK globalBondStretchScaleFactor double 1
REMARK globalBondTorsionScaleFactor double 1
REMARK globalCoulombScaleFactor double 0
REMARK globalGbsaScaleFactor double 0
REMARK globalVdwScaleFactor double 0
REMARK inQVectorFileName String ./last.qVector.1.dat
REMARK initialSeparation double 20
REMARK integratorAccuracy double 0.0001
REMARK integratorStepSize int 0.001
REMARK integratorType String RungeKuttaMerson
REMARK lastStage int 2
REMARK leontisWesthofInFileName String parameters.csv
REMARK loadTinkerParameterFile bool 0
REMARK outQVectorFileName String ./last.qVector.2.dat
REMARK magnesiumIonChainId String X
REMARK magnesiumIonRadius String 25
REMARK matchHydrogenAtomLocations bool 0 : If false, do not read the hydrogen atom positions from the input pdb file. Just guess new atom locations. This is useful if the hydrogens are in bad (e.g. colinear) locations.
REMARK matchExact bool 1 If True, this matches all bond lengths, angles, and dihedrals to the 2-, 3-, and 4- neighbor atom sets. Locally the match will be nearly perfect, but over a long biopolymer error can accumulate.
REMARK matchIdealized bool 0 If True, the bond lengths and angles will be set to default (idealized) values and the torsion angles will be iteratively adjusted to match the input structure. Thus the global structure is likely to be good, but small-scale details will differ from those of the input structure. This is much more expensive than matchExact.
REMARK matchOptimize bool 0 If True, this matches all bond lengths, angles, and dihedrals to the 2-, 3-, and 4- neighbor atom sets. Locally the match will be nearly perfect, but over a long biopolymer error can accumulate.
REMARK minimize bool 0
REMARK monteCarloTemperature int 400
REMARK monteCarloTemperatureIncrement int 0.1
REMARK nastGlobalBondTorsionScaleFactor int 10
REMARK noseHooverTime double 10
REMARK numReportingIntervals int 200
REMARK outMonteCarloFileName String ./trajectory.MonteCarlo.2.pdb
REMARK outTrajectoryFileName String ./trajectory.2.pdb
REMARK planarityThreshold double 0.07
REMARK potentialType int HarmonicInverse
REMARK prioritize int 0
REMARK proteinCapping bool 0 : When true, adds terminal capping groups to protein chains.
REMARK randomizeInitialVelocities bool 0 : When true, adds a stochastic velocity to each body at the beginning of the stage.
REMARK readPreviousFrameFile bool 1
REMARK readMagnesiumPositionsFromFile bool 1
REMARK removeMomentumPeriod double 0
REMARK removeRigidBodyMomentum bool 0
REMARK reportingInterval double 2
REMARK restrainingForceConstant double 1e+06
REMARK restrainingTorqueConstant double 10000
REMARK rigidifyFormedHelices int 0
REMARK scrubberPeriod double 40
REMARK safeParameters int 1
REMARK setChiBondMobility int 0
REMARK setForceAndStericScrubber bool 0
REMARK setForceScrubber bool 0
REMARK setHelicalStacking bool 1
REMARK setRemoveBasePairsInRigidStretch bool 1
REMARK setTemperature bool 1
REMARK smallGroupInertiaMultiplier double 1
REMARK stackAllHelicalResidues bool 1
REMARK temperature bool 10
REMARK thermostatType String NoseHoover
REMARK tinkerParameterFileName String NOT-SET
REMARK useFixedStepSize bool 0
REMARK useMultithreadedComputation bool 0
REMARK useOpenMMAcceleration bool 0
REMARK vanderWallSphereRadius double 300
REMARK velocityRescalingInterval int 1
REMARK verbose int 0
REMARK vmdOutput int 0
REMARK waterDropletMake bool 0
REMARK waterInertiaMultiplier double 1
REMARK writeCoordinates bool 1
REMARK writeDoublePrecisionTrajectories bool 0
REMARK writeLastFrameFile bool 1
REMARK helixBondMobility BondMobility::Mobility3
REMARK loopBondMobility BondMobility::Mobility2
REMARK overallBondMobility BondMobility::Mobility1
REMARK chiBondMobility BondMobility::Mobility1

REMARK /bubo/home/h23/alext/MMB_src/src/RNABuilder.cpp:223 done with call to myParameterReader.printAllSettings

Could you please help me to know where am i going wrong?

Thanks .
cheers!
Deepak

[Deepak kumar]

Hi, I tried different options but still not getting the result. This is the command file I use .

RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG

removeRigidBodyMomentum False
constrainToGround A 1
mobilizer Rigid A 32 48
mobilizer Rigid A 53 78
mobilizer Rigid A 83 102
mobilizer Rigid A 139 160
mobilizer Rigid A 165 187
mobilizer Rigid A 220 229
constraint A 1 Weld A 229
setHelicalStacking FALSE
constraintTolerance .001
contact SelectedAtoms A FirstResidue LastResidue
numReportingIntervals 200
reportingInterval 2.0
firstStage 2
lastStage 2
leontisWesthofInFileName parameters.csv

temperature 10.0

baseInteraction A 30 WatsonCrick A 145 WatsonCrick Cis
baseInteraction A 33 WatsonCrick A 142 WatsonCrick Cis
baseInteraction A 34 WatsonCrick A 141 WatsonCrick Cis
baseInteraction A 36 WatsonCrick A 139 WatsonCrick Cis
baseInteraction A 38 WatsonCrick A 90 WatsonCrick Trans
baseInteraction A 39 Hoogsteen A 92 SugarEdge Trans
baseInteraction A 41 WatsonCrick A 66 WatsonCrick Cis
baseInteraction A 42 WatsonCrick A 65 WatsonCrick Cis
baseInteraction A 43 WatsonCrick A 64 WatsonCrick Cis
baseInteraction A 44 WatsonCrick A 63 WatsonCrick Cis
baseInteraction A 45 WatsonCrick A 61 WatsonCrick Cis
baseInteraction A 46 WatsonCrick A 60 WatsonCrick Cis
baseInteraction A 67 WatsonCrick A 93 WatsonCrick Cis
baseInteraction A 68 WatsonCrick A 92 WatsonCrick Cis
baseInteraction A 73 WatsonCrick A 87 WatsonCrick Cis
baseInteraction A 74 WatsonCrick A 86 WatsonCrick Cis
baseInteraction A 74 WatsonCrick A 87 WatsonCrick Cis
baseInteraction A 75 WatsonCrick A 85 WatsonCrick Cis
baseInteraction A 78 WatsonCrick A 84 WatsonCrick Cis
#baseInteraction A 79 WatsonCrick A 81 Hoogsteen Trans
baseInteraction A 79 WatsonCrick A 82 WatsonCrick Cis
baseInteraction A 96 WatsonCrick A 100 Hoogsteen Trans
baseInteraction A 97 WatsonCrick A 170 WatsonCrick Cis
baseInteraction A 99 WatsonCrick A 169 WatsonCrick Cis
#baseInteraction A 99 Hoogsteen A 229 WatsonCrick Cis
baseInteraction A 100 WatsonCrick A 168 WatsonCrick Cis
baseInteraction A 101 Hoogsteen A 164 Hoogsteen Trans
baseInteraction A 101 WatsonCrick A 167 WatsonCrick Cis
baseInteraction A 102 WatsonCrick A 166 WatsonCrick Cis
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 104 WatsonCrick A 135 WatsonCrick Cis
baseInteraction A 105 WatsonCrick A 134 WatsonCrick Cis
baseInteraction A 106 WatsonCrick A 133 WatsonCrick Cis
baseInteraction A 109 WatsonCrick A 128 WatsonCrick Cis
baseInteraction A 113 WatsonCrick A 124 WatsonCrick Cis
baseInteraction A 114 WatsonCrick A 123 WatsonCrick Cis
baseInteraction A 115 WatsonCrick A 122 WatsonCrick Cis
#baseInteraction A 116 WatsonCrick A 121 WatsonCrick Cis
#baseInteraction A 128 Hoogsteen A 133 SugarEdge Trans
baseInteraction A 151 WatsonCrick A 161 WatsonCrick Cis
baseInteraction A 171 WatsonCrick A 228 WatsonCrick Cis
baseInteraction A 174 WatsonCrick A 220 WatsonCrick Cis
baseInteraction A 177 WatsonCrick A 188 WatsonCrick Cis
baseInteraction A 178 WatsonCrick A 187 WatsonCrick Cis
baseInteraction A 179 WatsonCrick A 186 WatsonCrick Cis
baseInteraction A 180 WatsonCrick A 185 WatsonCrick Cis
#baseInteraction A 181 SugarEdge A 184 Hoogsteen Trans
baseInteraction A 191 WatsonCrick A 218 WatsonCrick Cis
baseInteraction A 192 WatsonCrick A 217 WatsonCrick Cis
baseInteraction A 194 WatsonCrick A 216 WatsonCrick Cis
baseInteraction A 195 WatsonCrick A 213 SugarEdge Cis
#baseInteraction A 195 SugarEdge A 214 Hoogsteen Trans
#baseInteraction A 195 SugarEdge A 215 WatsonCrick Cis
#baseInteraction A 196 SugarEdge A 198 Hoogsteen Cis
#baseInteraction A 196 SugarEdge A 199 WatsonCrick Cis
baseInteraction A 201 WatsonCrick A 209 WatsonCrick Cis
baseInteraction A 202 WatsonCrick A 208 WatsonCrick Cis
#baseInteraction A 203 SugarEdge A 206 WatsonCrick Trans
baseInteraction A 69 WatsonCrick A 90 Hoogsteen Trans
#baseInteraction A 81 Hoogsteen A 84 Hoogsteen Cis
baseInteraction A 98 WatsonCrick A 170 SugarEdge Trans
baseInteraction A 106 Hoogsteen A 128 SugarEdge Trans
baseInteraction A 110 WatsonCrick A 133 WatsonCrick Trans
baseInteraction A 192 WatsonCrick A 216 WatsonCrick Trans
baseInteraction A 42 WatsonCrick A 94 SugarEdge Cis
baseInteraction A 62 WatsonCrick A 163 SugarEdge Cis
baseInteraction A 71 Hoogsteen A 89 SugarEdge Trans
baseInteraction A 71 Hoogsteen A 140 SugarEdge Trans
#baseInteraction A 104 Hoogsteen A 166 SugarEdge Trans
baseInteraction A 107 WatsonCrick A 129 SugarEdge Trans
#baseInteraction A 110 SugarEdge A 134 SugarEdge Trans
#baseInteraction A 111 SugarEdge A 126 WatsonCrick Trans
#baseInteraction A 112 Hoogsteen A 125 SugarEdge Trans
#baseInteraction A 197 SugarEdge A 200 Hoogsteen Trans
baseInteraction A 22 Hoogsteen A 151 SugarEdge Cis
baseInteraction A 36 SugarEdge A 70 SugarEdge Cis
baseInteraction A 38 SugarEdge A 69 SugarEdge Cis
baseInteraction A 39 SugarEdge A 68 SugarEdge Cis
#baseInteraction A 40 SugarEdge A 41 Hoogsteen Trans
#baseInteraction A 40 SugarEdge A 93 SugarEdge Trans
#baseInteraction A 58 SugarEdge A 59 Hoogsteen Cis
#baseInteraction A 63 Hoogsteen A 95 WatsonCrick Trans
#baseInteraction A 69 SugarEdge A 70 Hoogsteen Cis
#baseInteraction A 77 SugarEdge A 78 Hoogsteen Cis
baseInteraction A 81 Hoogsteen A 82 SugarEdge Cis
#baseInteraction A 97 SugarEdge A 98 Hoogsteen Cis
baseInteraction A 104 SugarEdge A 167 SugarEdge Cis
baseInteraction A 105 Hoogsteen A 167 SugarEdge Cis
baseInteraction A 127 Hoogsteen A 133 SugarEdge Cis
#baseInteraction A 128 Hoogsteen A 130 SugarEdge Cis
#baseInteraction A 193 SugarEdge A 194 Hoogsteen Trans
#baseInteraction A 213 SugarEdge A 214 Hoogsteen Cis

Thanks.

[Samuel Flores]

First, you are starting at stage 2 so you have to put both chains together into a file called 'last.1.pdb'. Look at the tutorial to understand what stages are about. Get rid of the "END" statements. may as well strip out the 'CONECT' records, since you won't be using them.

There is also a problem with C'5 atom of chain A , residue 80. its geometry is a bit odd -- almost collinear with O5' and C4'. Moving it by +1Å in the Z direction fixes that. However there are then additional residues with problems. Residue 104 seems to have similar geometric issues. You will need to go through and identify all the residues that create bond geometry problems, until MMB can instantiate the molecules. I do this by truncating different lengths off the 3' end in the command file until MMB can execute.

Also, I am not sure that you need the various baseInteraction's in your command file. That is for folding based on base-pairing contacts. However here I think you want to basically morph your model onto your template. The command for doing that is "threading" .. see the reference guide for syntax.

I think what you are trying to do is simple enough and will work. Let me know how this goes.

Sam

[Samuel Flores]

what is your goal, in any case? Will you be doing an experiment based on this result?

Sam

[Deepak kumar]

Thank you for your informative suggestions. I was committing mistake in the "stage". I have corrected it and now it works.

yes,I am trying to morph model to the template because after initial modeling process there are few regions not morphed well.

If you look at the command file below I have not used "threading" but have fixed the regions modeled well between the template and the target and let free the regions not modeled well to attain a conformation close to template.

do you think that "threading" should be done between the template and target residues for better morph and RMSD?


Apart from this I have few queries regarding MMB that I would like to ask you:

a) Is it mandatory to give base interactions to the command file ? If no, how MMb figures out the base interactions like of helix, loop and other secondary structures of a system? I use RNAview tool to get the base interaction information.

b) There are some interactions not allowed in the MMB tool like:

s/h cis and trans

h/w cis and trans

s/w cis and trans

Could you please tell how these interactions are handled by MMB? I have set Helicalstacking FALSE in my case because I am using RNAview tool to get the base interaction info. This tool gives info about the helical stacking too.

c) If you could tell me what these interactions refer to in MMB :

WatsonCrick Bifurcated Cis

Superimpose Superimpose Cis

The command file that works is :

RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG

removeRigidBodyMomentum False
constrainToGround A 1
mobilizer Rigid A 32 48
mobilizer Rigid A 53 78
mobilizer Rigid A 83 102
mobilizer Rigid A 139 160
mobilizer Rigid A 165 187
mobilizer Rigid A 220 229
constraint A 1 Weld A 229
setHelicalStacking FALSE

constraintTolerance .001
contact SelectedAtoms A FirstResidue LastResidue
numReportingIntervals 200
reportingInterval 2.0
firstStage 1
lastStage 2
leontisWesthofInFileName parameters.csv

temperature 10.0

baseInteraction A 30 WatsonCrick A 145 WatsonCrick Cis
baseInteraction A 33 WatsonCrick A 142 WatsonCrick Cis
baseInteraction A 34 WatsonCrick A 141 WatsonCrick Cis
baseInteraction A 36 WatsonCrick A 139 WatsonCrick Cis
baseInteraction A 38 WatsonCrick A 90 WatsonCrick Trans
baseInteraction A 39 Hoogsteen A 92 SugarEdge Trans
baseInteraction A 41 WatsonCrick A 66 WatsonCrick Cis
baseInteraction A 42 WatsonCrick A 65 WatsonCrick Cis
baseInteraction A 43 WatsonCrick A 64 WatsonCrick Cis
baseInteraction A 44 WatsonCrick A 63 WatsonCrick Cis
baseInteraction A 45 WatsonCrick A 61 WatsonCrick Cis
baseInteraction A 46 WatsonCrick A 60 WatsonCrick Cis
baseInteraction A 67 WatsonCrick A 93 WatsonCrick Cis
baseInteraction A 68 WatsonCrick A 92 WatsonCrick Cis
baseInteraction A 73 WatsonCrick A 87 WatsonCrick Cis
baseInteraction A 74 WatsonCrick A 86 WatsonCrick Cis
baseInteraction A 74 WatsonCrick A 87 WatsonCrick Cis
baseInteraction A 75 WatsonCrick A 85 WatsonCrick Cis
baseInteraction A 78 WatsonCrick A 84 WatsonCrick Cis
#baseInteraction A 79 WatsonCrick A 81 Hoogsteen Trans
baseInteraction A 79 WatsonCrick A 82 WatsonCrick Cis
baseInteraction A 96 WatsonCrick A 100 Hoogsteen Trans
baseInteraction A 97 WatsonCrick A 170 WatsonCrick Cis
baseInteraction A 99 WatsonCrick A 169 WatsonCrick Cis
#baseInteraction A 99 Hoogsteen A 229 WatsonCrick Cis
baseInteraction A 100 WatsonCrick A 168 WatsonCrick Cis
baseInteraction A 101 Hoogsteen A 164 Hoogsteen Trans
baseInteraction A 101 WatsonCrick A 167 WatsonCrick Cis
baseInteraction A 102 WatsonCrick A 166 WatsonCrick Cis
baseInteraction A 103 WatsonCrick A 165 WatsonCrick Cis
baseInteraction A 104 WatsonCrick A 135 WatsonCrick Cis
baseInteraction A 105 WatsonCrick A 134 WatsonCrick Cis
baseInteraction A 106 WatsonCrick A 133 WatsonCrick Cis
baseInteraction A 109 WatsonCrick A 128 WatsonCrick Cis
baseInteraction A 113 WatsonCrick A 124 WatsonCrick Cis
baseInteraction A 114 WatsonCrick A 123 WatsonCrick Cis
baseInteraction A 115 WatsonCrick A 122 WatsonCrick Cis
#baseInteraction A 116 WatsonCrick A 121 WatsonCrick Cis
#baseInteraction A 128 Hoogsteen A 133 SugarEdge Trans
baseInteraction A 151 WatsonCrick A 161 WatsonCrick Cis
baseInteraction A 171 WatsonCrick A 228 WatsonCrick Cis
baseInteraction A 174 WatsonCrick A 220 WatsonCrick Cis
baseInteraction A 177 WatsonCrick A 188 WatsonCrick Cis
baseInteraction A 178 WatsonCrick A 187 WatsonCrick Cis
baseInteraction A 179 WatsonCrick A 186 WatsonCrick Cis
baseInteraction A 180 WatsonCrick A 185 WatsonCrick Cis
#baseInteraction A 181 SugarEdge A 184 Hoogsteen Trans
baseInteraction A 191 WatsonCrick A 218 WatsonCrick Cis
baseInteraction A 192 WatsonCrick A 217 WatsonCrick Cis
baseInteraction A 194 WatsonCrick A 216 WatsonCrick Cis
baseInteraction A 195 WatsonCrick A 213 SugarEdge Cis
#baseInteraction A 195 SugarEdge A 214 Hoogsteen Trans
#baseInteraction A 195 SugarEdge A 215 WatsonCrick Cis
#baseInteraction A 196 SugarEdge A 198 Hoogsteen Cis
#baseInteraction A 196 SugarEdge A 199 WatsonCrick Cis
baseInteraction A 201 WatsonCrick A 209 WatsonCrick Cis
baseInteraction A 202 WatsonCrick A 208 WatsonCrick Cis
#baseInteraction A 203 SugarEdge A 206 WatsonCrick Trans
baseInteraction A 69 WatsonCrick A 90 Hoogsteen Trans
#baseInteraction A 81 Hoogsteen A 84 Hoogsteen Cis
baseInteraction A 98 WatsonCrick A 170 SugarEdge Trans
baseInteraction A 106 Hoogsteen A 128 SugarEdge Trans
baseInteraction A 110 WatsonCrick A 133 WatsonCrick Trans
baseInteraction A 192 WatsonCrick A 216 WatsonCrick Trans
baseInteraction A 42 WatsonCrick A 94 SugarEdge Cis
baseInteraction A 62 WatsonCrick A 163 SugarEdge Cis
baseInteraction A 71 Hoogsteen A 89 SugarEdge Trans
baseInteraction A 71 Hoogsteen A 140 SugarEdge Trans
#baseInteraction A 104 Hoogsteen A 166 SugarEdge Trans
baseInteraction A 107 WatsonCrick A 129 SugarEdge Trans
#baseInteraction A 110 SugarEdge A 134 SugarEdge Trans
#baseInteraction A 111 SugarEdge A 126 WatsonCrick Trans
#baseInteraction A 112 Hoogsteen A 125 SugarEdge Trans
#baseInteraction A 197 SugarEdge A 200 Hoogsteen Trans
baseInteraction A 22 Hoogsteen A 151 SugarEdge Cis
baseInteraction A 36 SugarEdge A 70 SugarEdge Cis
baseInteraction A 38 SugarEdge A 69 SugarEdge Cis
baseInteraction A 39 SugarEdge A 68 SugarEdge Cis
#baseInteraction A 40 SugarEdge A 41 Hoogsteen Trans
#baseInteraction A 40 SugarEdge A 93 SugarEdge Trans
#baseInteraction A 58 SugarEdge A 59 Hoogsteen Cis
#baseInteraction A 63 Hoogsteen A 95 WatsonCrick Trans
#baseInteraction A 69 SugarEdge A 70 Hoogsteen Cis
#baseInteraction A 77 SugarEdge A 78 Hoogsteen Cis
baseInteraction A 81 Hoogsteen A 82 SugarEdge Cis
#baseInteraction A 97 SugarEdge A 98 Hoogsteen Cis
baseInteraction A 104 SugarEdge A 167 SugarEdge Cis
baseInteraction A 105 Hoogsteen A 167 SugarEdge Cis
baseInteraction A 127 Hoogsteen A 133 SugarEdge Cis
#baseInteraction A 128 Hoogsteen A 130 SugarEdge Cis
#baseInteraction A 193 SugarEdge A 194 Hoogsteen Trans
#baseInteraction A 213 SugarEdge A 214 Hoogsteen Cis

[Samuel Flores]

Hi Deepak,



do you think that "threading" should be done between the template and
target residues for better morph and RMSD?

If I understand your goals correctly, yes. I think your target is chain A, and your template is chain B. However you command file does not instantiate chain B. So you are not copying or using any structural information from chain B. I think you may just be applying base pairing forces which merely confirm the existing base pairing interactions, rather than moving the molecule into a new conformation.

moving the molecule into a new conformation.



Apart from this I have few queries regarding MMB that I would like to ask
you:

a) Is it mandatory to give base interactions to the command file ? If no,
how MMb figures out the base interactions like of helix, loop and other
secondary structures of a system? I use RNAview tool to get the base
interaction information.


No, this is not required. In your case you could rigidify the domains of your molecule which already have the desired 3D structure. Or, the threading command could copy the structure from template to target.

b) There are some interactions not allowed in the MMB tool like:

s/h cis and trans

h/w cis and trans

s/w cis and trans


This are allowed. However they must be specified in the order h/s (not s/h), w/h, and w/s, just as they are in leontis and westhof's paper. So just reverse the order in your command file, and of course also reverse the order of the residue numbers.


Could you please tell how these interactions are handled by MMB? I have set
Helicalstacking FALSE in my case because I am using RNAview tool to get the
base interaction info. This tool gives info about the helical stacking too.

Again, I think you don't need the WatsonCrick / WatsonCrick interactions in your case. But if you do use them it doesn't hurt to leave HelicalStacking TRUE, because you are not otherwise specifying the stacking interactions. Thus you could get a situation in which the Watson-Crick interactions are enforced, but the stacking that would make a helical geometry does not occur.


c) If you could tell me what these interactions refer to in MMB :

WatsonCrick Bifurcated Cis

This is an interaction in Leontis and Westhof's paper. I can't tell you much about it, other than that if it's in that paper it's been observed experimentally. I think it looks somewhat, but not quite, like a Watson-Crick interaction.


Superimpose Superimpose Cis

This is not exactly a base pairing interaction -- rather it brings two bases so they superimpose on each other. It's somewhat obsolete. You don't need to use this, because the "threading" command is better.

I tried to run your command file. I suspect you're not using the structures you provided. Maybe your last.1.pdb doesn't have chain A? If that's true, don't you want to start with the known structure of chain A? Much easier than folding it entirely from base pairing information. Also you're not using chain B at all, which means you're not doing any sort of threading or morphing.

I don't know how much time I can dedicate to this, but you might want to provide your last.1.pdb as well. But first, try thinking about your goals, and look at the threading example in my tutorial.

Sam

[Deepak kumar]

Thanks again. I am using "threading" . The command file is :


firstStage 2
lastStage 2
reportingInterval .5
numReportingIntervals 60

# b -- "target" fragment
RNA B 1 GACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCGCGCAGCCAAGUCCUAAGUCAACAGGAGACUGUUGAUAUGGAUGCAGUACACAGACUAGAUGUCGGCCGGGGAAGAUGUAUUCUUCUCAUAAGGUAUAGUCGGACCUCUCCCGAAAGGGAGUUGGAGUACUCG

# "threaded" fragment
RNA A 1 GAGCCUUUAUACAGUAAUGUAUAUCGAAAAAUCCUCUAAUUCAGGGAACACCUAAGGCAAUCCUGAGCUAAGCUCUUAGUAAUAAGAGAAAGUGCAACGACUAUUCCGAUAGGAAGUAGGGUCAAGUGACUCGAAAUGGGGAUUACCCUUCUAGGGUAGUGAUAUAGUCUGAACAUAUAUGGAAACAUAUAGAAGGAUAGGAGUAACGAACCUAUCCGUAACAUAAUUG


mobilizer Rigid B 1 247
contact AllHeavyAtomSterics A 1 229

#Threading forces
threading A 32 48 B 3 19 300
threading A 53 78 B 106 131 300
threading A 83 102 B 152 171 300
threading A 139 160 B 176 197 300
threading A 165 187 B 211 233 300
threading A 220 229 B 238 247 300

The process is running . Will let you know how it goes.
I would like to tell about what I am trying to do :

Before I mention the process in brief, here are the names I refer to
native structure and model : chain A
template structure : chain B

I am doing a sanity test. I have 2 structures already available. I am using one as a template and the other as target. In this case chain A is the target and chain B is the template. I generated the alignment from structural superposition and used this alignment to generate a model for chain A using chain B as template. Once the model got generated, I superposed the model on to the native chain A structure already available but the RMSD was large because some regions were not modeled well. For these regions I tried using MMB , to get a conformation close to the native structure. For accomplishing this task:

In the previous command file I was following the steps mentioned in the tutorial exercise 5 "Reading structures from a pdb file and rigidifying the model parts " because I have a model already generated. I was trying to fix the well aligned regions and let the insertions/deletions be free to attain a conformation close to native structure.

I was not using threading because if am right its like a process of generating the model based on the alignment (rigidifying the well aligned regions) from scratch?
Since I already have a model generated I was trying to get good conformation of the not well modeled regions using the exercise 5 mentioned above.
Since, now i have mentioned the goal could you give ur suggestions about if threading is better or rigidifying the model parts?

Thanks.

[Samuel Flores]

Hi Deepak,

The "contact" command applies collision detecting spheres. These days "Physics where you want it" runs fast enough to use on many parts of your system. But it's OK to use "contact" for now .. let's return to that once you have progressed a bit with your current modeling.

Don't forget to also use the "constraint .. Weld .." command to keep two strands of a helix together, when the two strands are not part of the same rigid stretch.

I am concerned that you are starting with a chain A which was constructed with another threading package, not MMB. This can introduce many bad bond geometries (in terms of bond length, angle, and chirality). One may need to go back and repair some of these.

"I was not using threading because if am right its like a process of generating the model based on the alignment (rigidifying the well aligned regions) from scratch?
Since I already have a model generated I was trying to get good conformation of the not well modeled regions using the exercise 5 mentioned above.
Since, now i have mentioned the goal could you give ur suggestions about if threading is better or rigidifying the model parts?"

I am not sure I understand all the details of what you're doing. But I think what you are saying is that chain A has partially correct structure, but there are gaps and badly inserted residues. This is a common problem with many threading methods. It is possible to repair bad bonds in MMB, by setting their mobilities to "Free" using the "bondMobility" command, then letting the force field equilibrate them. You may need to adjust the nuclear coordinates a bit first, if you have problems with collinear bonds, planarity or chirality.

I think it will be congnitively much easier to just focus on one insertion/deletion and work on fixing that, rather than trying to fix the whole structure at once. Why not flexibilize just one of these problem areas, and try threading or repairing bonds just on that? Again if you provide your last.1.pdb it will be easier to see what is going on.

Sam



You may find it pro