Modelling Insertions, RNA homology Modelling

[Lee Xiong An]

Hi Sam,

I got two questions. Firstly, is it was possible to insert secondary structure information onto the insertions. Secondly, while using MMB builder, there were some criss-crossing of the structures, are there any ways to correct these?

Xiong An



* Trival bug in linux version
The excecutables in the linux versions seems to have problems calling the libraries unless it is in the same folder, or sym-linked, might cause problems for less it savvy people .

[Samuel Flores]

yes, the inserted residues are treated like any other residues. So you can apply base pairing forces to them.

the spiderwebby effect is probably a viewer issue. If your initial structure has clashes, your viewer will probably get the bond network wrong. In VMD, I usually load a fully extended , sterically kosher chain first, then follow with my folded/clashy frames. VMD will get the bond network from the first frame loaded.

If you append your commands.dat I may be able to help you better.

[Samuel Flores]

How did it go?

Thanks for pointing out the library issue. What version of MMB are you using? Possibly it is the tutorial which is wrong. I will have to make sure it is telling people to set LD_LIBRARY_PATH the right way.

sam

[Lee Xiong An]

Thanks Sam for your very prompt reply and concern ! I elaborated more on my problems below !

yes, the inserted residues are treated like any other residues. So you can apply base pairing forces to them.

I used commands nucleicAcidDuplex or baseInteraction C 26 WatsonCrick C 13 WatsonCrick Cis, but the helix became an extended loop

the spiderwebby effect is probably a viewer issue. If your initial structure has clashes, your viewer will probably get the bond network wrong. In VMD, I usually load a fully extended , sterically kosher chain first, then follow with my folded/clashy frames. VMD will get the bond network from the first frame loaded.

If you append your commands.dat I may be able to help you better.

I was trying to do validation of multi template modelling on 2cky. I broke 2cky into two templates, and tried to model back 2cky using two separate parts. There were certain problems with the loops as seen here, being right over left on magenta (template) ,and vice versa for (blue (model).

Thanks for pointing out the library issue. What version of MMB are you using? Possibly it is the tutorial which is wrong. I will have to make sure it is telling people to set LD_LIBRARY_PATH the right way.

I am using MMB 2.17. I found parameter.csv file also not in the bin folder, hope its not my mistakes in installation.


Xiong An

# CORRECT contents of commands.P6ab-threading.dat :

# Before running this, copy the provided 1GID.shifted.pdb to last.1.pdb in your working directory

firstStage 2
lastStage 2

# The reporting interval is set empirically, it has no particular physical meaning in this case:
reportingInterval .5
numReportingIntervals 80

# TETRAHYMENA P6ab -- "template" fragment
RNA Z 2 GGGACCAGGGGUGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC
RNA A 13 GCUUGUUCACAGGC



# AZOARCUS -- "target" or threaded fragment
RNA C 1 GGGACCAGGGGUGCUUGUUCACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC


mobilizer Rigid Z 2 66
mobilizer Rigid A 13 26

# Old way to prevent steric clashes, as described in Flores & Altman, RNA 2010:
#contact AllHeavyAtomSterics C 146 164

# More modern way, using "Physics where you want it" applied to target only:
setDefaultMDParameters
includeResidues C 1 15
includeResidues C 28 77
# Note that for large molecules, the force field can get expensive. In such cases, try threading it in parts.

#Alignment forces. More modern way, which pulls together like-named atoms in corresponding residues:
# First, specify that the alignment is explicit, rather than using a SeqAn gapped alignment. Internally, this simply applies a high penalty to gaps:
alignmentForces noGap
# Next, specify the force constant for the alignment springs. There is not much physical meaning to this choice of force constant, it is just empirically sufficient to pull the chains together nicely:
alignmentForces forceConstant 300.0
# Finally, specify corresponding residue stretches to be pulled together on template and target:
alignmentForces Z 2 16 C 1 15
alignmentForces Z 17 66 C 28 77
alignmentForces A 13 26 C 13 26
#nucleicAcidDuplex C 13 17 C 26 22
#baseInteraction C 26 WatsonCrick C 13 WatsonCrick Cis
#baseInteraction C 25 WatsonCrick C 14 WatsonCrick Cis
#baseInteraction C 24 WatsonCrick C 15 WatsonCrick Cis
#baseInteraction C 23 WatsonCrick C 16 WatsonCrick Cis
#baseInteraction C 22 WatsonCrick C 17 WatsonCrick Cis

[Samuel Flores]

Sorry I lost track of this thread. It is not clear to me what you are doing. Homology modeling should use the alignmentForces command. If you have issued setDefaultMDParameters this turns on the Amber99 potential which you have to be careful about, because it can repel all the atoms and counter what you are trying to do with the alignmentForces. I would first leave out the setDefaultMDParameters command. Later you can put it in, but make sure the alignmentForces are strong enough to counter it. Also make sure the template is excluded from the Amber99 forces.

Let me know how you are doing.

[Lee Xiong An]

Yes, i was trying to validate homology modelling with insertions, a validation example is the SAM riboswitch. There are three different loop lengths in PDB structures, though all share a similar core aptmer. It is shown in the picture below. For purposes in the post, i shall call them small, medium and large riboswitches.

I am trying to model the Large/medium riboswitch, based on the template of the small riboswitch, which means i have to model the loops. i was wondering how could i model the loops , based on secondary structure, or perhaps based on a template of the loop. I tried using a physics based force field, but the base pairs do not form even with the nucleicAcidDuplex command.

i cant seem to also find the command to continue the modelling after an unfinished run. Is there such a command?

[Samuel Flores]

nucleicAcidDuplex will work with the force field turned on, but you have to do two things:

1. Make sure the base pairing forces are strong enough. You can increase them by 100 or 1000x just to test.
2. Make sure the MD forces are turned off for the template.

I am afraid you will probably have to play with it a bit. I have an example on making a hairpin in the tutorial. You might play with that a bit.

To continue a run is very simple. Let's say your run had

firstStage 2
lastStage 2

Then the last structure written by MMB will be called last.2.pdb

So you can restart at stage 3:
firstStage 3
lastStage 3

MMB will read the structure from last.2.pdb. It will write trajectory.3.pdb, and finally last.3.pdb.

Regarding your earlier question about the loop topology being wrong, this does happen at times. You can use the scrubber (look for this in the tutorial) or try folding the strand a little at a time to coax it into folding the right way.

Sam

[Lee Xiong An]

nucleicAcidDuplex will work with the force field turned on, but you have to do two things:

1. Make sure the base pairing forces are strong enough. You can increase them by 100 or 1000x just to test.
2. Make sure the MD forces are turned off for the template.

I am afraid you will probably have to play with it a bit. I have an example on making a hairpin in the tutorial. You might play with that a bit.

To continue a run is very simple. Let's say your run had

firstStage 2
lastStage 2

Then the last structure written by MMB will be called last.2.pdb

So you can restart at stage 3:
firstStage 3
lastStage 3

MMB will read the structure from last.2.pdb. It will write trajectory.3.pdb, and finally last.3.pdb.

Regarding your earlier question about the loop topology being wrong, this does happen at times. You can use the scrubber (look for this in the tutorial) or try folding the strand a little at a time to coax it into folding the right way.

Sam

Hi Sam,

I have managed to get the base pairing working, after turning on the FF. For the scrubber, i think it is a very ingenious method to escape kinetic traps. But i was wondering, might scrubbing cause numerical errors? I have not tried it yet though.

Xiong An

[Samuel Flores]

thanks for your kind words. I guess the scrubber is pretty nice but I am not sure it is so novel. It is effectively potential rescaling and simulated annealing. In any case numerical instability has not been an issue. I agree it sounds violent but the forces are not large and sudden enought to forces are usually not a big deal in internal coordinates. Instabilities arise more as a result of poor geometry, which I think is not a problem for you at present.

Sam