# To run this example, issue: # cp tRNA.pdb last.1.pdb # also make sure you have tRNA.xplor in the current directory. # And follow the tutorial guide! matchFast RNA V 5 CGCGGGAUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUCAAAUCCGGCCCCCGCAA mobilizer Rigid V 5 77 removeRigidBodyMomentum false densityForceConstant 1.00 densityFileName ./tRNA.xplor fitToDensity V initialSeparation 20 temperature 1 numReportingIntervals 100 reportingInterval 1 #reportingInterval 10.00 firstStage 2 lastStage 2