# To run this example, issue:
# cp tRNA.pdb last.1.pdb
# also make sure you have tRNA.xplor in the current directory.
# And follow the tutorial guide!


RNA V 5       CGCGGGAUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUCAAAUCCGGCCCCCGCAA

# Set bondMobility for all residues in all chains (in this case there is only one) to Rigid:
mobilizer Rigid 

removeRigidBodyMomentum false

# This is constant that multiplies the density forces. In this case we leave it at the default value of unity:
densityForceConstant 1.00

# This file contains the density map in XPLOR format:
densityFileName ./tRNA.xplor

# This fits chain V to the density map:
fitToDensity V

# These parameters should be familiar by now:
temperature 1
numReportingIntervals 100
reportingInterval 1    

firstStage 2    
lastStage 2